Incidental Mutation 'R6610:Vmn2r31'
ID525887
Institutional Source Beutler Lab
Gene Symbol Vmn2r31
Ensembl Gene ENSMUSG00000096373
Gene Namevomeronasal 2, receptor 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R6610 (G1)
Quality Score141.008
Status Not validated
Chromosome7
Chromosomal Location7383027-7399743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7384589 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 661 (V661E)
Ref Sequence ENSEMBL: ENSMUSP00000074613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075108]
Predicted Effect probably damaging
Transcript: ENSMUST00000075108
AA Change: V661E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074613
Gene: ENSMUSG00000096373
AA Change: V661E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1e-33 PFAM
Pfam:NCD3G 512 565 1.4e-20 PFAM
Pfam:7tm_3 598 833 8.1e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Vmn2r31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Vmn2r31 APN 7 7396566 missense probably damaging 0.98
IGL01536:Vmn2r31 APN 7 7384848 missense probably damaging 1.00
IGL01985:Vmn2r31 APN 7 7394511 missense probably benign
IGL02116:Vmn2r31 APN 7 7394549 missense probably damaging 0.97
FR4304:Vmn2r31 UTSW 7 7384608 missense probably damaging 1.00
R1609:Vmn2r31 UTSW 7 7384889 missense probably damaging 1.00
R4647:Vmn2r31 UTSW 7 7384368 missense probably damaging 1.00
R4724:Vmn2r31 UTSW 7 7384758 missense possibly damaging 0.63
R4824:Vmn2r31 UTSW 7 7387063 critical splice donor site probably null
R5619:Vmn2r31 UTSW 7 7384530 nonsense probably null
R6225:Vmn2r31 UTSW 7 7394639 missense probably benign 0.19
R6956:Vmn2r31 UTSW 7 7394506 missense probably benign
R7111:Vmn2r31 UTSW 7 7396481 missense probably damaging 0.99
R7219:Vmn2r31 UTSW 7 7387106 missense probably benign
R7219:Vmn2r31 UTSW 7 7394398 missense probably damaging 0.97
R7300:Vmn2r31 UTSW 7 7384776 missense possibly damaging 0.61
R7395:Vmn2r31 UTSW 7 7384745 missense probably damaging 1.00
R7481:Vmn2r31 UTSW 7 7384580 missense possibly damaging 0.94
R8015:Vmn2r31 UTSW 7 7384200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATGCTGAGAGTGTTCATC -3'
(R):5'- TCTGCATTCACAGCTGTGG -3'

Sequencing Primer
(F):5'- CCATGCTGAGAGTGTTCATCAATATC -3'
(R):5'- CATTCACAGCTGTGGTACTTTG -3'
Posted On2018-06-22