Incidental Mutation 'R6642:Kctd20'
ID525888
Institutional Source Beutler Lab
Gene Symbol Kctd20
Ensembl Gene ENSMUSG00000005936
Gene Namepotassium channel tetramerisation domain containing 20
Synonyms2410004N11Rik, D17Ertd562e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R6642 (G1)
Quality Score222.009
Status Validated
Chromosome17
Chromosomal Location28951950-28969549 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28961666 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 138 (H138L)
Ref Sequence ENSEMBL: ENSMUSP00000131435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057174] [ENSMUST00000117672] [ENSMUST00000118762] [ENSMUST00000122163] [ENSMUST00000153462] [ENSMUST00000153831] [ENSMUST00000168507]
Predicted Effect probably damaging
Transcript: ENSMUST00000057174
AA Change: H138L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062282
Gene: ENSMUSG00000005936
AA Change: H138L

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
BTB 117 222 1.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117672
AA Change: H67L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113740
Gene: ENSMUSG00000005936
AA Change: H67L

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
BTB 46 151 1.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118762
AA Change: H67L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112890
Gene: ENSMUSG00000005936
AA Change: H67L

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
BTB 46 151 1.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122163
AA Change: H138L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112957
Gene: ENSMUSG00000005936
AA Change: H138L

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
BTB 117 222 1.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150858
Predicted Effect possibly damaging
Transcript: ENSMUST00000153462
AA Change: H67L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120301
Gene: ENSMUSG00000005936
AA Change: H67L

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
BTB 46 151 1.77e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000153831
AA Change: H67L

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122690
Gene: ENSMUSG00000005936
AA Change: H67L

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
BTB 46 151 1.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168507
AA Change: H138L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131435
Gene: ENSMUSG00000005936
AA Change: H138L

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
BTB 117 222 1.77e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Kctd20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02218:Kctd20 APN 17 28957903 missense probably benign 0.36
IGL02253:Kctd20 APN 17 28961486 missense probably benign 0.12
R0839:Kctd20 UTSW 17 28957898 start codon destroyed possibly damaging 0.79
R1270:Kctd20 UTSW 17 28966931 missense possibly damaging 0.87
R1768:Kctd20 UTSW 17 28962850 missense probably damaging 1.00
R1768:Kctd20 UTSW 17 28966781 missense probably damaging 1.00
R4797:Kctd20 UTSW 17 28966792 missense probably damaging 1.00
R5990:Kctd20 UTSW 17 28966910 missense probably benign 0.01
R6799:Kctd20 UTSW 17 28963377 splice site probably null
R6938:Kctd20 UTSW 17 28961581 missense probably benign
R7393:Kctd20 UTSW 17 28963338 missense probably damaging 1.00
R7862:Kctd20 UTSW 17 28962875 missense probably damaging 1.00
R8050:Kctd20 UTSW 17 28952758 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACAAGGGCTCATGCTTCCAG -3'
(R):5'- AAACAGCGGGACTTAGGTCTC -3'

Sequencing Primer
(F):5'- GCTCATGCTTCCAGAGTGG -3'
(R):5'- TCTGACCTTTGCAACTCAGAGAG -3'
Posted On2018-06-22