Incidental Mutation 'R6642:Aip'
ID525890
Institutional Source Beutler Lab
Gene Symbol Aip
Ensembl Gene ENSMUSG00000024847
Gene Namearyl-hydrocarbon receptor-interacting protein
SynonymsD19Bwg1412e, Fkbp16, Xap2, Ara9
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6642 (G1)
Quality Score204.009
Status Validated
Chromosome19
Chromosomal Location4114446-4125858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4115149 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 240 (C240F)
Ref Sequence ENSEMBL: ENSMUSP00000113807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025767] [ENSMUST00000049658] [ENSMUST00000100022] [ENSMUST00000117831] [ENSMUST00000121402]
Predicted Effect probably damaging
Transcript: ENSMUST00000025767
AA Change: C240F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025767
Gene: ENSMUSG00000024847
AA Change: C240F

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 5.3e-11 PFAM
PDB:4APO|B 166 330 1e-113 PDB
SCOP:d1ihga1 170 322 1e-14 SMART
Blast:TPR 231 264 3e-7 BLAST
Blast:TPR 265 298 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000049658
SMART Domains Protein: ENSMUSP00000054309
Gene: ENSMUSG00000024851

DomainStartEndE-ValueType
Pfam:IP_trans 1 252 2e-145 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100022
SMART Domains Protein: ENSMUSP00000097599
Gene: ENSMUSG00000024851

DomainStartEndE-ValueType
Pfam:IP_trans 1 250 1.6e-113 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117831
AA Change: C240F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113807
Gene: ENSMUSG00000024847
AA Change: C240F

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 1e-10 PFAM
PDB:4APO|B 166 330 1e-113 PDB
SCOP:d1ihga1 170 322 1e-14 SMART
Blast:TPR 231 264 3e-7 BLAST
Blast:TPR 265 298 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121402
SMART Domains Protein: ENSMUSP00000114096
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151957
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes an Hsp90-associated protein that is localized to the cytoplasm. The encoded protein interacts with the aryl hydrocarbon receptor (AhR) and the tyrosine kinase receptor RET, inhibits AhR ubiquitination, and regulates the intracellular localization of AhR. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality from E10 to E19. Mice exhibit cardiac malformations such as double outlet right ventricle and ventricular septal defect and sometimes hemorrhage or petechiae. Mice homozygous for a hypomorphic allele exhibit patent ductus venosus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Aip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Aip APN 19 4121397 missense probably damaging 0.99
R0331:Aip UTSW 19 4118247 missense probably damaging 1.00
R2244:Aip UTSW 19 4114796 missense probably benign
R5219:Aip UTSW 19 4115180 missense probably benign 0.06
R5840:Aip UTSW 19 4116010 missense possibly damaging 0.64
R6167:Aip UTSW 19 4115188 missense probably benign 0.30
R6815:Aip UTSW 19 4116066 missense probably benign
R7016:Aip UTSW 19 4121402 missense probably benign 0.00
R7097:Aip UTSW 19 4115381 missense probably benign 0.02
R7316:Aip UTSW 19 4114793 missense probably benign 0.03
R8025:Aip UTSW 19 4115346 missense probably benign 0.16
R8374:Aip UTSW 19 4115456 missense probably damaging 1.00
R8444:Aip UTSW 19 4116034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCTGGTCAGGCTCTTG -3'
(R):5'- AGTACTATGACGCCATCGCC -3'

Sequencing Primer
(F):5'- GTGGGGAGCTCAGAGATGTC -3'
(R):5'- TGCCTCAAGAATCTGCAGATG -3'
Posted On2018-06-22