Incidental Mutation 'R6610:Zfp426'
ID525898
Institutional Source Beutler Lab
Gene Symbol Zfp426
Ensembl Gene ENSMUSG00000059475
Gene Namezinc finger protein 426
SynonymsZfo61, Zfp68-rs1, 2900057C04Rik, KRAB1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6610 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20468549-20492746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20473093 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 98 (K98R)
Ref Sequence ENSEMBL: ENSMUSP00000127045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080386] [ENSMUST00000115562] [ENSMUST00000163348] [ENSMUST00000163427] [ENSMUST00000164250] [ENSMUST00000164799] [ENSMUST00000164825] [ENSMUST00000166005] [ENSMUST00000167457] [ENSMUST00000168095] [ENSMUST00000169269] [ENSMUST00000169558]
Predicted Effect probably damaging
Transcript: ENSMUST00000080386
AA Change: K84R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079250
Gene: ENSMUSG00000059475
AA Change: K84R

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115562
AA Change: K84R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111224
Gene: ENSMUSG00000059475
AA Change: K84R

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157997
Predicted Effect probably benign
Transcript: ENSMUST00000163348
AA Change: K84R

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126446
Gene: ENSMUSG00000059475
AA Change: K84R

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 218 240 2.12e-4 SMART
ZnF_C2H2 273 295 1.69e-3 SMART
ZnF_C2H2 301 323 8.81e-2 SMART
ZnF_C2H2 329 351 5.59e-4 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 1.43e-1 SMART
ZnF_C2H2 413 435 1.79e-2 SMART
ZnF_C2H2 441 463 1.22e-4 SMART
ZnF_C2H2 469 491 1.38e-3 SMART
ZnF_C2H2 497 519 3.58e-2 SMART
ZnF_C2H2 527 549 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163427
AA Change: N42D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000164250
Predicted Effect probably benign
Transcript: ENSMUST00000164799
SMART Domains Protein: ENSMUSP00000130120
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 53 93 1.2e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164825
AA Change: K84R

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127914
Gene: ENSMUSG00000059475
AA Change: K84R

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166005
AA Change: K84R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129727
Gene: ENSMUSG00000059475
AA Change: K84R

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166465
Predicted Effect possibly damaging
Transcript: ENSMUST00000167457
AA Change: K17R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130945
Gene: ENSMUSG00000059475
AA Change: K17R

DomainStartEndE-ValueType
KRAB 1 32 1.46e0 SMART
ZnF_C2H2 152 174 2.12e-4 SMART
ZnF_C2H2 207 229 1.69e-3 SMART
ZnF_C2H2 235 257 8.81e-2 SMART
ZnF_C2H2 263 285 5.59e-4 SMART
ZnF_C2H2 291 313 3.16e-3 SMART
ZnF_C2H2 319 341 1.43e-1 SMART
ZnF_C2H2 347 369 1.79e-2 SMART
ZnF_C2H2 375 397 1.22e-4 SMART
ZnF_C2H2 403 425 1.38e-3 SMART
ZnF_C2H2 431 453 3.58e-2 SMART
ZnF_C2H2 461 483 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168095
AA Change: N83D

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130309
Gene: ENSMUSG00000059475
AA Change: N83D

DomainStartEndE-ValueType
KRAB 39 83 1.37e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169269
SMART Domains Protein: ENSMUSP00000128843
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 39 69 7.16e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169558
AA Change: K98R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127045
Gene: ENSMUSG00000059475
AA Change: K98R

DomainStartEndE-ValueType
KRAB 53 113 5.56e-31 SMART
ZnF_C2H2 233 255 2.12e-4 SMART
ZnF_C2H2 288 310 1.69e-3 SMART
ZnF_C2H2 316 338 8.81e-2 SMART
ZnF_C2H2 344 366 5.59e-4 SMART
ZnF_C2H2 372 394 3.16e-3 SMART
ZnF_C2H2 400 422 1.43e-1 SMART
ZnF_C2H2 428 450 1.79e-2 SMART
ZnF_C2H2 456 478 1.22e-4 SMART
ZnF_C2H2 484 506 1.38e-3 SMART
ZnF_C2H2 512 534 3.58e-2 SMART
ZnF_C2H2 542 564 3.44e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180846
Meta Mutation Damage Score 0.1367 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kaposi's sarcoma-associated herpesvirus (KSHV) can be reactivated from latency by the viral protein RTA. The protein encoded by this gene is a zinc finger transcriptional repressor that interacts with RTA to modulate RTA-mediated reactivation of KSHV. While the encoded protein can repress KSHV reactivation, RTA can induce degradation of this protein through the ubiquitin-proteasome pathway to overcome the repression. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Zfp426
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Zfp426 APN 9 20478157 start codon destroyed possibly damaging 0.93
IGL02499:Zfp426 APN 9 20473118 splice site probably benign
R0157:Zfp426 UTSW 9 20471136 missense probably benign 0.00
R0356:Zfp426 UTSW 9 20471245 missense probably benign 0.15
R0456:Zfp426 UTSW 9 20470297 missense probably damaging 1.00
R0504:Zfp426 UTSW 9 20470031 missense probably damaging 0.96
R2352:Zfp426 UTSW 9 20470105 missense probably benign 0.08
R2507:Zfp426 UTSW 9 20470431 missense probably benign 0.00
R2509:Zfp426 UTSW 9 20470681 missense possibly damaging 0.68
R3771:Zfp426 UTSW 9 20473117 splice site probably null
R3772:Zfp426 UTSW 9 20473117 splice site probably null
R3773:Zfp426 UTSW 9 20473117 splice site probably null
R3864:Zfp426 UTSW 9 20470086 missense possibly damaging 0.88
R4649:Zfp426 UTSW 9 20470627 missense possibly damaging 0.66
R4798:Zfp426 UTSW 9 20471014 missense probably benign 0.17
R4863:Zfp426 UTSW 9 20470038 missense probably damaging 1.00
R4894:Zfp426 UTSW 9 20475073 intron probably benign
R5421:Zfp426 UTSW 9 20470719 missense probably damaging 0.99
R6084:Zfp426 UTSW 9 20470627 missense possibly damaging 0.66
R7239:Zfp426 UTSW 9 20470591 missense probably benign 0.00
R7441:Zfp426 UTSW 9 20470851 missense possibly damaging 0.95
R7646:Zfp426 UTSW 9 20470024 missense probably damaging 0.98
R7827:Zfp426 UTSW 9 20470150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCATCAATCCATTCACTTACTGAG -3'
(R):5'- TGGGACTTGCATTACCAATCC -3'

Sequencing Primer
(F):5'- GGCTTGGTCGAAAACGCCTTTAC -3'
(R):5'- CACTTCTGGAATTCAAGTACCTGGG -3'
Posted On2018-06-22