Incidental Mutation 'R6610:Tyk2'
ID525900
Institutional Source Beutler Lab
Gene Symbol Tyk2
Ensembl Gene ENSMUSG00000032175
Gene Nametyrosine kinase 2
SynonymsJTK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6610 (G1)
Quality Score152.008
Status Validated
Chromosome9
Chromosomal Location21104068-21131243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 21108016 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1014 (Q1014K)
Ref Sequence ENSEMBL: ENSMUSP00000150214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001036] [ENSMUST00000214454] [ENSMUST00000216874]
Predicted Effect probably benign
Transcript: ENSMUST00000001036
AA Change: Q1037K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000001036
Gene: ENSMUSG00000032175
AA Change: Q1037K

DomainStartEndE-ValueType
B41 29 301 1.51e-26 SMART
Blast:B41 408 460 3e-12 BLAST
SH2 470 562 1.26e-2 SMART
STYKc 612 886 8.89e-15 SMART
TyrKc 917 1189 6.48e-114 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213717
Predicted Effect probably benign
Transcript: ENSMUST00000214454
AA Change: Q1014K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216874
AA Change: Q1037K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.1678 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with hyperimmunoglobulin E syndrome (HIES) - a primary immunodeficiency characterized by elevated serum immunoglobulin E. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile, but differ from wild-type with respect to interleukin 12 mediated T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Tyk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Tyk2 APN 9 21120588 missense probably benign 0.27
IGL01015:Tyk2 APN 9 21120700 missense probably benign 0.00
IGL01096:Tyk2 APN 9 21108863 missense probably damaging 1.00
IGL01410:Tyk2 APN 9 21109364 missense probably damaging 1.00
IGL01613:Tyk2 APN 9 21120576 missense probably damaging 0.99
IGL01997:Tyk2 APN 9 21110494 missense probably damaging 1.00
IGL02249:Tyk2 APN 9 21120407 missense probably damaging 1.00
IGL02407:Tyk2 APN 9 21109227 splice site probably benign
IGL02538:Tyk2 APN 9 21111043 missense possibly damaging 0.94
IGL03185:Tyk2 APN 9 21109384 missense probably damaging 1.00
ANU74:Tyk2 UTSW 9 21116158 missense probably damaging 1.00
R0355:Tyk2 UTSW 9 21114190 splice site probably null
R0667:Tyk2 UTSW 9 21108871 missense probably damaging 1.00
R0862:Tyk2 UTSW 9 21116167 missense probably benign 0.00
R0883:Tyk2 UTSW 9 21111137 missense possibly damaging 0.61
R1554:Tyk2 UTSW 9 21107922 missense probably damaging 0.96
R1575:Tyk2 UTSW 9 21115462 missense probably benign 0.00
R1664:Tyk2 UTSW 9 21120353 missense probably damaging 1.00
R1676:Tyk2 UTSW 9 21115249 nonsense probably null
R1843:Tyk2 UTSW 9 21121554 nonsense probably null
R1871:Tyk2 UTSW 9 21121441 missense probably damaging 1.00
R2044:Tyk2 UTSW 9 21120341 missense probably damaging 1.00
R2137:Tyk2 UTSW 9 21110985 intron probably benign
R2197:Tyk2 UTSW 9 21115207 missense probably damaging 1.00
R2883:Tyk2 UTSW 9 21110587 missense probably benign 0.01
R2941:Tyk2 UTSW 9 21111119 missense probably benign 0.00
R3001:Tyk2 UTSW 9 21109321 missense probably benign 0.00
R3002:Tyk2 UTSW 9 21109321 missense probably benign 0.00
R3196:Tyk2 UTSW 9 21124032 missense possibly damaging 0.80
R3622:Tyk2 UTSW 9 21127310 missense probably damaging 0.98
R4024:Tyk2 UTSW 9 21115919 missense probably damaging 1.00
R4459:Tyk2 UTSW 9 21124415 missense probably damaging 1.00
R4604:Tyk2 UTSW 9 21108009 missense probably damaging 1.00
R4664:Tyk2 UTSW 9 21114207 missense probably damaging 0.99
R4666:Tyk2 UTSW 9 21114207 missense probably damaging 0.99
R4915:Tyk2 UTSW 9 21111137 missense probably benign 0.41
R4971:Tyk2 UTSW 9 21120501 critical splice donor site probably null
R5014:Tyk2 UTSW 9 21115830 splice site probably null
R5191:Tyk2 UTSW 9 21107497 missense probably damaging 0.98
R5305:Tyk2 UTSW 9 21109381 missense probably damaging 0.99
R5356:Tyk2 UTSW 9 21115744 missense probably benign 0.03
R5501:Tyk2 UTSW 9 21121612 missense probably damaging 1.00
R6025:Tyk2 UTSW 9 21115960 missense probably benign 0.05
R6113:Tyk2 UTSW 9 21107922 missense probably damaging 1.00
R6159:Tyk2 UTSW 9 21110504 missense probably damaging 0.99
R6608:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6612:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6870:Tyk2 UTSW 9 21124954 missense probably damaging 1.00
R7216:Tyk2 UTSW 9 21120526 missense probably benign 0.01
R7218:Tyk2 UTSW 9 21105054 missense probably damaging 1.00
R7298:Tyk2 UTSW 9 21108860 missense probably benign 0.35
R7322:Tyk2 UTSW 9 21110204 missense probably benign
R7347:Tyk2 UTSW 9 21108034 missense probably damaging 0.99
R7759:Tyk2 UTSW 9 21120258 critical splice donor site probably null
R7840:Tyk2 UTSW 9 21124967 missense probably damaging 1.00
R7854:Tyk2 UTSW 9 21115480 missense probably benign
R8312:Tyk2 UTSW 9 21115649 missense possibly damaging 0.69
Z1177:Tyk2 UTSW 9 21105367 missense probably benign
Z1177:Tyk2 UTSW 9 21108875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGTCCTTAAGCCACGCC -3'
(R):5'- GTAGAGATTTGCGTTTGACCC -3'

Sequencing Primer
(F):5'- TGCCCCCTCCGACAATG -3'
(R):5'- GCGTTTGACCCTTCCCACAAAG -3'
Posted On2018-06-22