Incidental Mutation 'R6643:Ttl'
ID525910
Institutional Source Beutler Lab
Gene Symbol Ttl
Ensembl Gene ENSMUSG00000027394
Gene Nametubulin tyrosine ligase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6643 (G1)
Quality Score155.008
Status Validated
Chromosome2
Chromosomal Location129065942-129096283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129081342 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 201 (I201T)
Ref Sequence ENSEMBL: ENSMUSP00000046883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035812]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035812
AA Change: I201T

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046883
Gene: ENSMUSG00000027394
AA Change: I201T

DomainStartEndE-ValueType
Pfam:TTL 54 367 1.2e-72 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144120
AA Change: I59T
SMART Domains Protein: ENSMUSP00000117506
Gene: ENSMUSG00000027394
AA Change: I59T

DomainStartEndE-ValueType
Pfam:TTL 1 199 2.3e-64 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TTL is a cytosolic enzyme involved in the posttranslational modification of alpha-tubulin (see MIM 602529). Alpha-tubulin within assembled microtubules is detyrosinated over time at the C terminus. After microtubule disassembly, TTL restores the tyrosine residues and consequently participates in a cycle of tubulin detyrosination and tyrosination (Erck et al., 2003 [PubMed 14571137]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, impaired breathing, and fail to form the internal capsule in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,457,074 S140P probably damaging Het
Atp5g1 A C 11: 96,074,028 C17W probably damaging Het
Brd4 A G 17: 32,198,496 S161P unknown Het
Cntrob A G 11: 69,311,422 V448A possibly damaging Het
Col22a1 T C 15: 71,822,037 probably null Het
Col6a4 T C 9: 106,000,631 Y2049C probably damaging Het
Cpn1 C T 19: 43,960,033 D395N probably benign Het
Csmd2 A G 4: 128,372,597 T769A probably benign Het
Cts6 T A 13: 61,201,793 H62L probably damaging Het
Ddx42 G T 11: 106,228,820 V144F probably benign Het
E130308A19Rik A G 4: 59,720,561 S698G possibly damaging Het
Eif2b3 T C 4: 117,070,757 L391P probably damaging Het
Gm1043 T C 5: 37,173,551 I525T probably benign Het
Kifc1 C T 17: 33,885,855 G59S probably benign Het
Lancl1 T C 1: 67,004,383 E360G probably benign Het
Lrp4 T C 2: 91,501,995 L1679S probably benign Het
Mroh9 T A 1: 163,075,561 D91V probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ntsr1 T C 2: 180,500,926 I170T probably damaging Het
Olfr1346 G A 7: 6,474,721 D204N probably benign Het
Olfr430 T C 1: 174,070,045 L249P probably damaging Het
Olfr697 T A 7: 106,741,704 I77F probably benign Het
Olfr698 A G 7: 106,752,569 I273T probably benign Het
Pcolce T A 5: 137,608,903 T109S probably damaging Het
Reg3b C A 6: 78,372,922 S148R possibly damaging Het
Rps6ka4 A G 19: 6,832,363 S365P probably damaging Het
Slc27a4 A G 2: 29,812,848 E563G probably benign Het
Slc4a10 C T 2: 62,228,710 T187M possibly damaging Het
Slc5a7 G T 17: 54,276,616 Q549K probably benign Het
Stxbp3 A G 3: 108,793,834 L573P probably damaging Het
Suco A T 1: 161,859,432 S120T possibly damaging Het
Tnni2 G T 7: 142,444,279 G163V probably damaging Het
Vmn1r28 A G 6: 58,265,960 T263A probably benign Het
Wdr1 A T 5: 38,540,178 D262E probably damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zdbf2 A G 1: 63,304,508 E682G possibly damaging Het
Other mutations in Ttl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02742:Ttl APN 2 129066293 missense possibly damaging 0.50
IGL02970:Ttl APN 2 129076070 missense probably damaging 1.00
R0363:Ttl UTSW 2 129076061 missense probably damaging 0.99
R2290:Ttl UTSW 2 129081270 missense possibly damaging 0.69
R3818:Ttl UTSW 2 129092994 missense probably damaging 1.00
R4345:Ttl UTSW 2 129075858 missense probably damaging 1.00
R4471:Ttl UTSW 2 129082057 missense probably benign
R4866:Ttl UTSW 2 129081227 missense probably damaging 1.00
R5269:Ttl UTSW 2 129068911 missense probably damaging 1.00
R5913:Ttl UTSW 2 129076041 missense probably benign
R5941:Ttl UTSW 2 129075984 missense probably benign 0.00
R6287:Ttl UTSW 2 129089121 missense probably damaging 1.00
R6821:Ttl UTSW 2 129068915 missense probably damaging 1.00
R6883:Ttl UTSW 2 129082072 missense possibly damaging 0.81
R8273:Ttl UTSW 2 129068933 missense probably benign 0.05
R8354:Ttl UTSW 2 129066184 missense probably damaging 1.00
R8403:Ttl UTSW 2 129081243 missense possibly damaging 0.87
R8454:Ttl UTSW 2 129066184 missense probably damaging 1.00
R8817:Ttl UTSW 2 129068858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCTTACTGAGCTGGACTAG -3'
(R):5'- ATGGCTTATCCGCATAATGAGG -3'

Sequencing Primer
(F):5'- GCTGGACTAGCGTCTTGC -3'
(R):5'- GCTTATCCGCATAATGAGGCAAATG -3'
Posted On2018-06-22