Incidental Mutation 'R6610:Nab2'
ID525912
Institutional Source Beutler Lab
Gene Symbol Nab2
Ensembl Gene ENSMUSG00000025402
Gene NameNgfi-A binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6610 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127660918-127668568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127664338 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 295 (I295N)
Ref Sequence ENSEMBL: ENSMUSP00000096761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026469] [ENSMUST00000092074] [ENSMUST00000099157] [ENSMUST00000118728] [ENSMUST00000128780] [ENSMUST00000129252]
Predicted Effect probably damaging
Transcript: ENSMUST00000026469
AA Change: I295N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026469
Gene: ENSMUSG00000025402
AA Change: I295N

DomainStartEndE-ValueType
Pfam:NCD1 36 114 1.2e-44 PFAM
Pfam:NCD2 230 364 3.2e-59 PFAM
low complexity region 393 406 N/A INTRINSIC
low complexity region 431 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092074
SMART Domains Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147

DomainStartEndE-ValueType
STAT_int 2 116 2.76e-31 SMART
Pfam:STAT_bind 273 526 4.4e-87 PFAM
SH2 540 622 1.33e-5 SMART
Pfam:STAT6_C 655 837 1.1e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099157
AA Change: I295N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096761
Gene: ENSMUSG00000025402
AA Change: I295N

DomainStartEndE-ValueType
Pfam:NCD1 34 115 4.4e-51 PFAM
Pfam:NCD2 199 366 3.6e-74 PFAM
low complexity region 393 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118728
SMART Domains Protein: ENSMUSP00000113473
Gene: ENSMUSG00000040195

DomainStartEndE-ValueType
Pfam:DUF2215 100 348 7.2e-105 PFAM
low complexity region 367 377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124388
Predicted Effect probably benign
Transcript: ENSMUST00000128780
SMART Domains Protein: ENSMUSP00000121737
Gene: ENSMUSG00000025402

DomainStartEndE-ValueType
Pfam:NCD1 1 66 3.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145470
Meta Mutation Damage Score 0.9323 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of NGFI-A binding (NAB) proteins, which function in the nucleus to repress transcription induced by some members of the EGR (early growth response) family of transactivators. NAB proteins can homo- or hetero-multimerize with other EGR or NAB proteins through a conserved N-terminal domain, and repress transcription through two partially redundant C-terminal domains. Transcriptional repression by the encoded protein is mediated in part by interactions with the nucleosome remodeling and deactylase (NuRD) complex. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal myelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Nab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Nab2 APN 10 127665109 missense probably damaging 1.00
IGL01415:Nab2 APN 10 127665103 missense probably damaging 1.00
IGL02248:Nab2 APN 10 127663240 missense probably benign 0.31
IGL03080:Nab2 APN 10 127664794 missense possibly damaging 0.56
IGL03084:Nab2 APN 10 127664477 missense probably damaging 1.00
katie UTSW 10 127664338 missense probably damaging 1.00
R0381:Nab2 UTSW 10 127665067 missense probably damaging 1.00
R1074:Nab2 UTSW 10 127663255 nonsense probably null
R1535:Nab2 UTSW 10 127665047 missense probably damaging 0.99
R4214:Nab2 UTSW 10 127665048 nonsense probably null
R4742:Nab2 UTSW 10 127662827 missense probably benign 0.02
R5590:Nab2 UTSW 10 127664657 missense probably damaging 0.98
R5603:Nab2 UTSW 10 127665121 start codon destroyed probably null 0.96
R5776:Nab2 UTSW 10 127664329 missense probably damaging 0.99
R6018:Nab2 UTSW 10 127664924 nonsense probably null
R6381:Nab2 UTSW 10 127664351 missense probably damaging 1.00
R7025:Nab2 UTSW 10 127666508 intron probably benign
R8220:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8221:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8222:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8223:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8277:Nab2 UTSW 10 127665299 intron probably benign
R8293:Nab2 UTSW 10 127666397 missense possibly damaging 0.86
RF005:Nab2 UTSW 10 127664364 missense probably benign 0.04
RF024:Nab2 UTSW 10 127664364 missense probably benign 0.04
Z1176:Nab2 UTSW 10 127663132 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGTGGGGACAGTCATACAG -3'
(R):5'- CAGAATCTGATGTTGGAGCAGG -3'

Sequencing Primer
(F):5'- TGGGGACAGTCATACAGAGGTG -3'
(R):5'- AGGAGTCTCTGAAGGGCCTG -3'
Posted On2018-06-22