Incidental Mutation 'R6610:Sec24a'
List |< first << previous [record 35 of 47] next >> last >|
ID525916
Institutional Source Beutler Lab
Gene Symbol Sec24a
Ensembl Gene ENSMUSG00000036391
Gene NameSec24 related gene family, member A (S. cerevisiae)
Synonyms9430090N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6610 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location51692264-51763634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 51696656 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1051 (V1051I)
Ref Sequence ENSEMBL: ENSMUSP00000104725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038210] [ENSMUST00000109097]
Predicted Effect probably benign
Transcript: ENSMUST00000038210
AA Change: V1050I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044370
Gene: ENSMUSG00000036391
AA Change: V1050I

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 423 461 8e-19 PFAM
Pfam:Sec23_trunk 497 735 1.2e-87 PFAM
Pfam:Sec23_BS 740 824 1.1e-23 PFAM
Pfam:Sec23_helical 836 938 5.1e-27 PFAM
Pfam:Gelsolin 960 1035 7.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109097
AA Change: V1051I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104725
Gene: ENSMUSG00000036391
AA Change: V1051I

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 425 462 2.4e-16 PFAM
Pfam:Sec23_trunk 498 736 7.8e-87 PFAM
Pfam:Sec23_BS 741 825 1.1e-22 PFAM
Pfam:Sec23_helical 838 938 6.9e-28 PFAM
Pfam:Gelsolin 961 1036 9.3e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that are homologous to yeast Sec24. This protein is a component of coat protein II (COPII)-coated vesicles that mediate protein transport from the endoplasmic reticulum. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased circulating cholesterol level, decreased circulating LDL cholesterol level, and abnormal liver physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Sec24a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Sec24a APN 11 51736504 nonsense probably null
IGL00973:Sec24a APN 11 51729577 critical splice acceptor site probably null
IGL01364:Sec24a APN 11 51713529 critical splice donor site probably null
IGL01476:Sec24a APN 11 51708956 missense possibly damaging 0.88
IGL01725:Sec24a APN 11 51723578 splice site probably null
IGL02069:Sec24a APN 11 51733934 splice site probably benign
IGL02230:Sec24a APN 11 51709034 missense possibly damaging 0.88
IGL02617:Sec24a APN 11 51712187 critical splice donor site probably null
IGL02655:Sec24a APN 11 51734655 missense probably benign 0.43
IGL02756:Sec24a APN 11 51696733 missense probably benign 0.02
IGL03396:Sec24a APN 11 51708967 missense probably benign 0.17
R0153:Sec24a UTSW 11 51700826 missense probably benign 0.08
R0506:Sec24a UTSW 11 51743795 missense probably benign 0.03
R0625:Sec24a UTSW 11 51729454 missense probably damaging 0.98
R1084:Sec24a UTSW 11 51713581 missense probably damaging 1.00
R1166:Sec24a UTSW 11 51733467 missense possibly damaging 0.72
R1376:Sec24a UTSW 11 51700913 splice site probably benign
R1487:Sec24a UTSW 11 51731886 missense possibly damaging 0.92
R1541:Sec24a UTSW 11 51743796 missense probably benign 0.41
R1582:Sec24a UTSW 11 51708967 missense probably benign 0.17
R1643:Sec24a UTSW 11 51704385 missense probably benign 0.03
R1672:Sec24a UTSW 11 51743948 nonsense probably null
R1681:Sec24a UTSW 11 51695189 missense probably damaging 0.98
R1756:Sec24a UTSW 11 51733763 splice site probably benign
R1992:Sec24a UTSW 11 51736363 missense probably benign 0.00
R2159:Sec24a UTSW 11 51712350 missense probably damaging 1.00
R2177:Sec24a UTSW 11 51704401 missense probably benign 0.00
R2188:Sec24a UTSW 11 51723584 missense probably damaging 0.99
R2271:Sec24a UTSW 11 51716450 missense possibly damaging 0.91
R3414:Sec24a UTSW 11 51729458 missense probably damaging 1.00
R4349:Sec24a UTSW 11 51715149 missense probably benign 0.03
R4396:Sec24a UTSW 11 51715164 missense possibly damaging 0.86
R4629:Sec24a UTSW 11 51721813 critical splice donor site probably null
R5061:Sec24a UTSW 11 51713532 splice site probably null
R5577:Sec24a UTSW 11 51734621 missense probably benign 0.06
R5717:Sec24a UTSW 11 51707210 missense probably benign
R5915:Sec24a UTSW 11 51756137 missense probably benign 0.11
R6175:Sec24a UTSW 11 51731891 missense probably damaging 1.00
R6341:Sec24a UTSW 11 51717776 missense probably damaging 0.99
R6461:Sec24a UTSW 11 51713546 missense possibly damaging 0.76
R6632:Sec24a UTSW 11 51713649 nonsense probably null
R6907:Sec24a UTSW 11 51712276 missense probably damaging 1.00
R6969:Sec24a UTSW 11 51700816 missense probably benign 0.35
R7132:Sec24a UTSW 11 51715136 nonsense probably null
R7274:Sec24a UTSW 11 51707255 missense probably damaging 1.00
R7475:Sec24a UTSW 11 51713552 missense probably damaging 1.00
R7699:Sec24a UTSW 11 51712257 missense probably damaging 1.00
R7700:Sec24a UTSW 11 51712257 missense probably damaging 1.00
R7935:Sec24a UTSW 11 51721922 missense probably benign 0.25
R8042:Sec24a UTSW 11 51704317 missense probably benign
R8345:Sec24a UTSW 11 51743778 missense probably benign 0.00
X0025:Sec24a UTSW 11 51729547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTCTTGTAAGACCAGACATTGAC -3'
(R):5'- TCTGGTCCAACAAAATCAACTG -3'

Sequencing Primer
(F):5'- ACCCTTTAATTCTAGCACTTGGAAGG -3'
(R):5'- CAGACAGATCTTCCAGAAC -3'
Posted On2018-06-22