Incidental Mutation 'R6643:E130308A19Rik'
ID525917
Institutional Source Beutler Lab
Gene Symbol E130308A19Rik
Ensembl Gene ENSMUSG00000045071
Gene NameRIKEN cDNA E130308A19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R6643 (G1)
Quality Score196.009
Status Validated
Chromosome4
Chromosomal Location59626211-59761439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59720561 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 698 (S698G)
Ref Sequence ENSEMBL: ENSMUSP00000062493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052420] [ENSMUST00000070150]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052420
AA Change: S698G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062493
Gene: ENSMUSG00000045071
AA Change: S698G

DomainStartEndE-ValueType
low complexity region 130 141 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:DUF3504 520 673 2.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070150
SMART Domains Protein: ENSMUSP00000065702
Gene: ENSMUSG00000045071

DomainStartEndE-ValueType
low complexity region 130 141 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
Pfam:DUF3504 532 687 4.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152797
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,457,074 S140P probably damaging Het
Atp5g1 A C 11: 96,074,028 C17W probably damaging Het
Brd4 A G 17: 32,198,496 S161P unknown Het
Cntrob A G 11: 69,311,422 V448A possibly damaging Het
Col22a1 T C 15: 71,822,037 probably null Het
Col6a4 T C 9: 106,000,631 Y2049C probably damaging Het
Cpn1 C T 19: 43,960,033 D395N probably benign Het
Csmd2 A G 4: 128,372,597 T769A probably benign Het
Cts6 T A 13: 61,201,793 H62L probably damaging Het
Ddx42 G T 11: 106,228,820 V144F probably benign Het
Eif2b3 T C 4: 117,070,757 L391P probably damaging Het
Gm1043 T C 5: 37,173,551 I525T probably benign Het
Kifc1 C T 17: 33,885,855 G59S probably benign Het
Lancl1 T C 1: 67,004,383 E360G probably benign Het
Lrp4 T C 2: 91,501,995 L1679S probably benign Het
Mroh9 T A 1: 163,075,561 D91V probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ntsr1 T C 2: 180,500,926 I170T probably damaging Het
Olfr1346 G A 7: 6,474,721 D204N probably benign Het
Olfr430 T C 1: 174,070,045 L249P probably damaging Het
Olfr697 T A 7: 106,741,704 I77F probably benign Het
Olfr698 A G 7: 106,752,569 I273T probably benign Het
Pcolce T A 5: 137,608,903 T109S probably damaging Het
Reg3b C A 6: 78,372,922 S148R possibly damaging Het
Rps6ka4 A G 19: 6,832,363 S365P probably damaging Het
Slc27a4 A G 2: 29,812,848 E563G probably benign Het
Slc4a10 C T 2: 62,228,710 T187M possibly damaging Het
Slc5a7 G T 17: 54,276,616 Q549K probably benign Het
Stxbp3 A G 3: 108,793,834 L573P probably damaging Het
Suco A T 1: 161,859,432 S120T possibly damaging Het
Tnni2 G T 7: 142,444,279 G163V probably damaging Het
Ttl T C 2: 129,081,342 I201T possibly damaging Het
Vmn1r28 A G 6: 58,265,960 T263A probably benign Het
Wdr1 A T 5: 38,540,178 D262E probably damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zdbf2 A G 1: 63,304,508 E682G possibly damaging Het
Other mutations in E130308A19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:E130308A19Rik APN 4 59737743 splice site probably benign
IGL00672:E130308A19Rik APN 4 59719697 missense probably benign 0.00
IGL00937:E130308A19Rik APN 4 59690846 missense probably benign 0.01
IGL01885:E130308A19Rik APN 4 59720004 missense probably benign 0.20
IGL02638:E130308A19Rik APN 4 59719676 nonsense probably null
H8562:E130308A19Rik UTSW 4 59691033 missense possibly damaging 0.70
R0044:E130308A19Rik UTSW 4 59690290 missense possibly damaging 0.86
R0523:E130308A19Rik UTSW 4 59719716 missense probably damaging 0.98
R0788:E130308A19Rik UTSW 4 59719847 missense possibly damaging 0.76
R1215:E130308A19Rik UTSW 4 59690743 missense probably benign 0.37
R1490:E130308A19Rik UTSW 4 59719746 missense probably damaging 0.99
R2292:E130308A19Rik UTSW 4 59690579 missense probably damaging 0.99
R3907:E130308A19Rik UTSW 4 59752393 missense probably benign 0.14
R4288:E130308A19Rik UTSW 4 59690308 missense probably benign 0.33
R4780:E130308A19Rik UTSW 4 59691057 missense probably benign 0.01
R4781:E130308A19Rik UTSW 4 59691057 missense probably benign 0.01
R4834:E130308A19Rik UTSW 4 59690317 nonsense probably null
R4985:E130308A19Rik UTSW 4 59691017 missense probably benign 0.01
R6123:E130308A19Rik UTSW 4 59737565 missense probably damaging 1.00
R6290:E130308A19Rik UTSW 4 59691332 missense probably benign 0.25
R6315:E130308A19Rik UTSW 4 59691132 missense probably benign
R6763:E130308A19Rik UTSW 4 59752288 missense probably damaging 0.99
R6980:E130308A19Rik UTSW 4 59719991 missense probably damaging 0.97
R7036:E130308A19Rik UTSW 4 59719991 missense probably damaging 0.97
R7078:E130308A19Rik UTSW 4 59737688 missense probably damaging 1.00
R7098:E130308A19Rik UTSW 4 59753004 missense possibly damaging 0.88
R7171:E130308A19Rik UTSW 4 59690333 missense probably damaging 1.00
R7247:E130308A19Rik UTSW 4 59690502 missense probably damaging 1.00
R7366:E130308A19Rik UTSW 4 59752770 missense probably damaging 0.99
R7916:E130308A19Rik UTSW 4 59719841 missense probably damaging 1.00
R8050:E130308A19Rik UTSW 4 59719767 missense probably damaging 1.00
Z1176:E130308A19Rik UTSW 4 59720313 missense probably damaging 1.00
Z1177:E130308A19Rik UTSW 4 59720223 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTATGCGCTATGAGGATG -3'
(R):5'- ACGCAATGCAGTACACATGATG -3'

Sequencing Primer
(F):5'- GCTATGAGGATGCCCCCTTC -3'
(R):5'- TACACATGATGGTTTCCTGGGACAC -3'
Posted On2018-06-22