Incidental Mutation 'R6643:Eif2b3'
ID525919
Institutional Source Beutler Lab
Gene Symbol Eif2b3
Ensembl Gene ENSMUSG00000028683
Gene Nameeukaryotic translation initiation factor 2B, subunit 3
Synonyms1190002P15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6643 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117019402-117087306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117070757 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 391 (L391P)
Ref Sequence ENSEMBL: ENSMUSP00000102056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070610] [ENSMUST00000106447] [ENSMUST00000106448]
Predicted Effect probably damaging
Transcript: ENSMUST00000070610
AA Change: L391P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070334
Gene: ENSMUSG00000028683
AA Change: L391P

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 8.2e-20 PFAM
Pfam:NTP_transf_3 5 226 8.5e-19 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106447
AA Change: L391P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102055
Gene: ENSMUSG00000028683
AA Change: L391P

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 1.1e-19 PFAM
Pfam:NTP_transf_3 5 221 1.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106448
AA Change: L391P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102056
Gene: ENSMUSG00000028683
AA Change: L391P

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 140 3.2e-19 PFAM
Pfam:NTP_transf_3 5 237 3.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155181
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the subunits of initiation factor eIF2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. It has also been found to function as a cofactor of hepatitis C virus internal ribosome entry site-mediated translation. Mutations in this gene have been associated with leukodystrophy with vanishing white matter. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,457,074 S140P probably damaging Het
Atp5g1 A C 11: 96,074,028 C17W probably damaging Het
Brd4 A G 17: 32,198,496 S161P unknown Het
Cntrob A G 11: 69,311,422 V448A possibly damaging Het
Col22a1 T C 15: 71,822,037 probably null Het
Col6a4 T C 9: 106,000,631 Y2049C probably damaging Het
Cpn1 C T 19: 43,960,033 D395N probably benign Het
Csmd2 A G 4: 128,372,597 T769A probably benign Het
Cts6 T A 13: 61,201,793 H62L probably damaging Het
Ddx42 G T 11: 106,228,820 V144F probably benign Het
E130308A19Rik A G 4: 59,720,561 S698G possibly damaging Het
Gm1043 T C 5: 37,173,551 I525T probably benign Het
Kifc1 C T 17: 33,885,855 G59S probably benign Het
Lancl1 T C 1: 67,004,383 E360G probably benign Het
Lrp4 T C 2: 91,501,995 L1679S probably benign Het
Mroh9 T A 1: 163,075,561 D91V probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ntsr1 T C 2: 180,500,926 I170T probably damaging Het
Olfr1346 G A 7: 6,474,721 D204N probably benign Het
Olfr430 T C 1: 174,070,045 L249P probably damaging Het
Olfr697 T A 7: 106,741,704 I77F probably benign Het
Olfr698 A G 7: 106,752,569 I273T probably benign Het
Pcolce T A 5: 137,608,903 T109S probably damaging Het
Reg3b C A 6: 78,372,922 S148R possibly damaging Het
Rps6ka4 A G 19: 6,832,363 S365P probably damaging Het
Slc27a4 A G 2: 29,812,848 E563G probably benign Het
Slc4a10 C T 2: 62,228,710 T187M possibly damaging Het
Slc5a7 G T 17: 54,276,616 Q549K probably benign Het
Stxbp3 A G 3: 108,793,834 L573P probably damaging Het
Suco A T 1: 161,859,432 S120T possibly damaging Het
Tnni2 G T 7: 142,444,279 G163V probably damaging Het
Ttl T C 2: 129,081,342 I201T possibly damaging Het
Vmn1r28 A G 6: 58,265,960 T263A probably benign Het
Wdr1 A T 5: 38,540,178 D262E probably damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zdbf2 A G 1: 63,304,508 E682G possibly damaging Het
Other mutations in Eif2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Eif2b3 APN 4 117066469 missense probably benign
IGL01333:Eif2b3 APN 4 117070690 missense probably benign 0.31
IGL01564:Eif2b3 APN 4 117028542 missense probably benign 0.00
IGL01721:Eif2b3 APN 4 117058804 missense probably damaging 1.00
IGL02061:Eif2b3 APN 4 117028411 missense possibly damaging 0.78
R0835:Eif2b3 UTSW 4 117058805 missense probably damaging 1.00
R0924:Eif2b3 UTSW 4 117081578 missense possibly damaging 0.93
R2167:Eif2b3 UTSW 4 117028540 missense probably damaging 1.00
R2424:Eif2b3 UTSW 4 117070848 missense probably benign 0.01
R3902:Eif2b3 UTSW 4 117022207 missense probably damaging 1.00
R4105:Eif2b3 UTSW 4 117081634 missense probably damaging 1.00
R4688:Eif2b3 UTSW 4 117058849 missense probably benign 0.03
R4998:Eif2b3 UTSW 4 117066392 missense probably benign 0.06
R5033:Eif2b3 UTSW 4 117052736 missense probably damaging 1.00
R5123:Eif2b3 UTSW 4 117022211 missense probably damaging 1.00
R5493:Eif2b3 UTSW 4 117086722 missense possibly damaging 0.92
R5787:Eif2b3 UTSW 4 117044440 missense probably damaging 1.00
R5789:Eif2b3 UTSW 4 117028495 missense probably damaging 1.00
R6347:Eif2b3 UTSW 4 117044566 missense probably benign 0.05
R6361:Eif2b3 UTSW 4 117028425 missense possibly damaging 0.66
R6798:Eif2b3 UTSW 4 117066458 missense probably benign 0.00
R7299:Eif2b3 UTSW 4 117052822 missense probably benign 0.27
R7301:Eif2b3 UTSW 4 117052822 missense probably benign 0.27
R7451:Eif2b3 UTSW 4 117052796 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCAGCTCAAAGAATGGGG -3'
(R):5'- CAGCAGTTTCTCACAGGAGC -3'

Sequencing Primer
(F):5'- CAGCTCAAAGAATGGGGGTTGATTTC -3'
(R):5'- AGTGATATTCTGAGTTCATGTCACTG -3'
Posted On2018-06-22