Incidental Mutation 'R6643:Gm1043'
ID 525925
Institutional Source Beutler Lab
Gene Symbol Gm1043
Ensembl Gene ENSMUSG00000070823
Gene Name predicted gene 1043
Synonyms LOC381634
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R6643 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 37185897-37193023 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37173551 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 525 (I525T)
Ref Sequence ENSEMBL: ENSMUSP00000147157 (fasta)
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000207619
Predicted Effect probably benign
Transcript: ENSMUST00000207866
AA Change: I525T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000208827
Predicted Effect probably benign
Transcript: ENSMUST00000232332
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,457,074 S140P probably damaging Het
Atp5g1 A C 11: 96,074,028 C17W probably damaging Het
Brd4 A G 17: 32,198,496 S161P unknown Het
Cntrob A G 11: 69,311,422 V448A possibly damaging Het
Col22a1 T C 15: 71,822,037 probably null Het
Col6a4 T C 9: 106,000,631 Y2049C probably damaging Het
Cpn1 C T 19: 43,960,033 D395N probably benign Het
Csmd2 A G 4: 128,372,597 T769A probably benign Het
Cts6 T A 13: 61,201,793 H62L probably damaging Het
Ddx42 G T 11: 106,228,820 V144F probably benign Het
E130308A19Rik A G 4: 59,720,561 S698G possibly damaging Het
Eif2b3 T C 4: 117,070,757 L391P probably damaging Het
Kifc1 C T 17: 33,885,855 G59S probably benign Het
Lancl1 T C 1: 67,004,383 E360G probably benign Het
Lrp4 T C 2: 91,501,995 L1679S probably benign Het
Mroh9 T A 1: 163,075,561 D91V probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ntsr1 T C 2: 180,500,926 I170T probably damaging Het
Olfr1346 G A 7: 6,474,721 D204N probably benign Het
Olfr430 T C 1: 174,070,045 L249P probably damaging Het
Olfr697 T A 7: 106,741,704 I77F probably benign Het
Olfr698 A G 7: 106,752,569 I273T probably benign Het
Pcolce T A 5: 137,608,903 T109S probably damaging Het
Reg3b C A 6: 78,372,922 S148R possibly damaging Het
Rps6ka4 A G 19: 6,832,363 S365P probably damaging Het
Slc27a4 A G 2: 29,812,848 E563G probably benign Het
Slc4a10 C T 2: 62,228,710 T187M possibly damaging Het
Slc5a7 G T 17: 54,276,616 Q549K probably benign Het
Stxbp3 A G 3: 108,793,834 L573P probably damaging Het
Suco A T 1: 161,859,432 S120T possibly damaging Het
Tnni2 G T 7: 142,444,279 G163V probably damaging Het
Ttl T C 2: 129,081,342 I201T possibly damaging Het
Vmn1r28 A G 6: 58,265,960 T263A probably benign Het
Wdr1 A T 5: 38,540,178 D262E probably damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zdbf2 A G 1: 63,304,508 E682G possibly damaging Het
Other mutations in Gm1043
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Gm1043 APN 5 37187089 missense probably damaging 1.00
R0138:Gm1043 UTSW 5 37192973 intron probably benign
R0724:Gm1043 UTSW 5 37187229 missense probably damaging 1.00
R3917:Gm1043 UTSW 5 37192941 intron probably benign
R5069:Gm1043 UTSW 5 37187236 missense probably damaging 1.00
R5996:Gm1043 UTSW 5 37159824 utr 3 prime probably benign
R6030:Gm1043 UTSW 5 37154608 utr 3 prime probably benign
R6030:Gm1043 UTSW 5 37154608 utr 3 prime probably benign
R6260:Gm1043 UTSW 5 37174472 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTTACCCACATCCATGCTCCAG -3'
(R):5'- GTCCAAGGACAGCTTCTCAC -3'

Sequencing Primer
(F):5'- ACATCCATGCTCCAGCTCTG -3'
(R):5'- AAGGACAGCTTCTCACTGTCTTG -3'
Posted On 2018-06-22