Incidental Mutation 'R6643:Gm1043'
ID525925
Institutional Source Beutler Lab
Gene Symbol Gm1043
Ensembl Gene ENSMUSG00000070823
Gene Namepredicted gene 1043
SynonymsLOC381634
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6643 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location37185897-37193023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37173551 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 525 (I525T)
Ref Sequence ENSEMBL: ENSMUSP00000147157 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000207619
Predicted Effect probably benign
Transcript: ENSMUST00000207866
AA Change: I525T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000208827
Predicted Effect probably benign
Transcript: ENSMUST00000232332
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,457,074 S140P probably damaging Het
Atp5g1 A C 11: 96,074,028 C17W probably damaging Het
Brd4 A G 17: 32,198,496 S161P unknown Het
Cntrob A G 11: 69,311,422 V448A possibly damaging Het
Col22a1 T C 15: 71,822,037 probably null Het
Col6a4 T C 9: 106,000,631 Y2049C probably damaging Het
Cpn1 C T 19: 43,960,033 D395N probably benign Het
Csmd2 A G 4: 128,372,597 T769A probably benign Het
Cts6 T A 13: 61,201,793 H62L probably damaging Het
Ddx42 G T 11: 106,228,820 V144F probably benign Het
E130308A19Rik A G 4: 59,720,561 S698G possibly damaging Het
Eif2b3 T C 4: 117,070,757 L391P probably damaging Het
Kifc1 C T 17: 33,885,855 G59S probably benign Het
Lancl1 T C 1: 67,004,383 E360G probably benign Het
Lrp4 T C 2: 91,501,995 L1679S probably benign Het
Mroh9 T A 1: 163,075,561 D91V probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ntsr1 T C 2: 180,500,926 I170T probably damaging Het
Olfr1346 G A 7: 6,474,721 D204N probably benign Het
Olfr430 T C 1: 174,070,045 L249P probably damaging Het
Olfr697 T A 7: 106,741,704 I77F probably benign Het
Olfr698 A G 7: 106,752,569 I273T probably benign Het
Pcolce T A 5: 137,608,903 T109S probably damaging Het
Reg3b C A 6: 78,372,922 S148R possibly damaging Het
Rps6ka4 A G 19: 6,832,363 S365P probably damaging Het
Slc27a4 A G 2: 29,812,848 E563G probably benign Het
Slc4a10 C T 2: 62,228,710 T187M possibly damaging Het
Slc5a7 G T 17: 54,276,616 Q549K probably benign Het
Stxbp3 A G 3: 108,793,834 L573P probably damaging Het
Suco A T 1: 161,859,432 S120T possibly damaging Het
Tnni2 G T 7: 142,444,279 G163V probably damaging Het
Ttl T C 2: 129,081,342 I201T possibly damaging Het
Vmn1r28 A G 6: 58,265,960 T263A probably benign Het
Wdr1 A T 5: 38,540,178 D262E probably damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zdbf2 A G 1: 63,304,508 E682G possibly damaging Het
Other mutations in Gm1043
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Gm1043 APN 5 37187089 missense probably damaging 1.00
R0138:Gm1043 UTSW 5 37192973 intron probably benign
R0724:Gm1043 UTSW 5 37187229 missense probably damaging 1.00
R3917:Gm1043 UTSW 5 37192941 intron probably benign
R5069:Gm1043 UTSW 5 37187236 missense probably damaging 1.00
R5996:Gm1043 UTSW 5 37159824 utr 3 prime probably benign
R6030:Gm1043 UTSW 5 37154608 utr 3 prime probably benign
R6030:Gm1043 UTSW 5 37154608 utr 3 prime probably benign
R6260:Gm1043 UTSW 5 37174472 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTTACCCACATCCATGCTCCAG -3'
(R):5'- GTCCAAGGACAGCTTCTCAC -3'

Sequencing Primer
(F):5'- ACATCCATGCTCCAGCTCTG -3'
(R):5'- AAGGACAGCTTCTCACTGTCTTG -3'
Posted On2018-06-22