Incidental Mutation 'R6610:Gsdmc2'
List |< first << previous [record 21 of 47] next >> last >|
ID525928
Institutional Source Beutler Lab
Gene Symbol Gsdmc2
Ensembl Gene ENSMUSG00000056293
Gene Namegasdermin C2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6610 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location63824346-63845177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63825008 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 438 (N438S)
Ref Sequence ENSEMBL: ENSMUSP00000140487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089900] [ENSMUST00000188404] [ENSMUST00000188691]
Predicted Effect probably benign
Transcript: ENSMUST00000089900
AA Change: N438S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000087344
Gene: ENSMUSG00000056293
AA Change: N438S

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.8e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185277
Predicted Effect probably benign
Transcript: ENSMUST00000188404
AA Change: N438S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141066
Gene: ENSMUSG00000056293
AA Change: N438S

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.7e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188691
AA Change: N438S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140487
Gene: ENSMUSG00000056293
AA Change: N438S

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.7e-148 PFAM
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Gsdmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Gsdmc2 APN 15 63828271 splice site probably benign
IGL02212:Gsdmc2 APN 15 63828062 splice site probably benign
IGL02394:Gsdmc2 APN 15 63835880 missense probably damaging 1.00
IGL02683:Gsdmc2 APN 15 63833412 missense probably damaging 1.00
R0046:Gsdmc2 UTSW 15 63827755 splice site probably benign
R0105:Gsdmc2 UTSW 15 63828177 missense probably benign
R0105:Gsdmc2 UTSW 15 63828177 missense probably benign
R0655:Gsdmc2 UTSW 15 63827773 missense probably benign 0.00
R1066:Gsdmc2 UTSW 15 63825050 missense possibly damaging 0.92
R1283:Gsdmc2 UTSW 15 63825057 missense probably damaging 0.99
R1691:Gsdmc2 UTSW 15 63833465 missense probably damaging 1.00
R1727:Gsdmc2 UTSW 15 63849779 unclassified probably benign
R1911:Gsdmc2 UTSW 15 63827772 missense probably benign 0.00
R1990:Gsdmc2 UTSW 15 63828237 missense probably benign 0.00
R1991:Gsdmc2 UTSW 15 63828237 missense probably benign 0.00
R2018:Gsdmc2 UTSW 15 63828126 splice site probably null
R2090:Gsdmc2 UTSW 15 63826826 missense probably benign 0.09
R3037:Gsdmc2 UTSW 15 63833331 missense probably benign 0.00
R3964:Gsdmc2 UTSW 15 63849834 unclassified probably benign
R4308:Gsdmc2 UTSW 15 63848705 unclassified probably benign
R4574:Gsdmc2 UTSW 15 63828023 critical splice donor site probably null
R4738:Gsdmc2 UTSW 15 63826801 nonsense probably null
R4873:Gsdmc2 UTSW 15 63828252 missense probably benign 0.41
R4875:Gsdmc2 UTSW 15 63828252 missense probably benign 0.41
R4883:Gsdmc2 UTSW 15 63835765 missense probably damaging 1.00
R5115:Gsdmc2 UTSW 15 63827768 missense probably benign 0.00
R5241:Gsdmc2 UTSW 15 63824894 missense probably benign 0.00
R5510:Gsdmc2 UTSW 15 63828196 missense probably benign
R5841:Gsdmc2 UTSW 15 63826210 missense probably benign 0.00
R5987:Gsdmc2 UTSW 15 63830866 missense probably benign 0.00
R6199:Gsdmc2 UTSW 15 63825113 missense probably benign 0.01
R6359:Gsdmc2 UTSW 15 63825017 missense probably damaging 1.00
R6984:Gsdmc2 UTSW 15 63825049 nonsense probably null
R7092:Gsdmc2 UTSW 15 63825098 missense probably damaging 0.99
R7204:Gsdmc2 UTSW 15 63825054 missense probably damaging 1.00
R7247:Gsdmc2 UTSW 15 63833334 missense probably benign 0.02
R7409:Gsdmc2 UTSW 15 63833346 missense possibly damaging 0.85
R7589:Gsdmc2 UTSW 15 63825043 missense probably damaging 1.00
R7636:Gsdmc2 UTSW 15 63828192 missense probably benign 0.00
R7658:Gsdmc2 UTSW 15 63825054 missense probably damaging 1.00
R7673:Gsdmc2 UTSW 15 63825083 missense probably damaging 1.00
R8017:Gsdmc2 UTSW 15 63826913 missense probably benign 0.28
R8019:Gsdmc2 UTSW 15 63826913 missense probably benign 0.28
R8368:Gsdmc2 UTSW 15 63825053 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGCCATAGCATCTTTATTCC -3'
(R):5'- GGTGTTGGGACAGATCTTACCC -3'

Sequencing Primer
(F):5'- TTATTCCCACTGGCCTAAAACATG -3'
(R):5'- AGAGCCTGGTTTGCCCAATC -3'
Posted On2018-06-22