Incidental Mutation 'R6610:Rpap3'
ID525930
Institutional Source Beutler Lab
Gene Symbol Rpap3
Ensembl Gene ENSMUSG00000022466
Gene NameRNA polymerase II associated protein 3
Synonyms2310042P20Rik, D15Ertd682e
MMRRC Submission
Accession Numbers

Genbank: NM_028003; MGI: 1277218

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6610 (G1)
Quality Score215.009
Status Validated
Chromosome15
Chromosomal Location97675097-97705825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97688168 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 314 (D314G)
Ref Sequence ENSEMBL: ENSMUSP00000023104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023104]
Predicted Effect probably benign
Transcript: ENSMUST00000023104
AA Change: D314G

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023104
Gene: ENSMUSG00000022466
AA Change: D314G

DomainStartEndE-ValueType
coiled coil region 9 45 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
TPR 134 167 1.12e-7 SMART
TPR 168 201 2.07e1 SMART
TPR 202 235 2.36e-6 SMART
low complexity region 252 273 N/A INTRINSIC
TPR 284 317 6.58e-5 SMART
TPR 318 351 4.45e-2 SMART
TPR 352 385 3.87e-2 SMART
Pfam:RPAP3_C 540 631 3.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(10) : Targeted, other(1) Gene trapped(9)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Rpap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01835:Rpap3 APN 15 97703239 missense possibly damaging 0.85
IGL02714:Rpap3 APN 15 97696577 missense possibly damaging 0.93
IGL03409:Rpap3 APN 15 97681739 missense possibly damaging 0.46
R0095:Rpap3 UTSW 15 97680536 splice site probably benign
R0847:Rpap3 UTSW 15 97703201 critical splice donor site probably null
R1496:Rpap3 UTSW 15 97686483 missense possibly damaging 0.86
R1562:Rpap3 UTSW 15 97694217 missense possibly damaging 0.86
R1603:Rpap3 UTSW 15 97701121 missense possibly damaging 0.53
R1801:Rpap3 UTSW 15 97694209 missense possibly damaging 0.73
R2163:Rpap3 UTSW 15 97680348 missense possibly damaging 0.71
R4969:Rpap3 UTSW 15 97686526 missense probably benign
R5226:Rpap3 UTSW 15 97703223 missense possibly damaging 0.53
R6613:Rpap3 UTSW 15 97681841 critical splice acceptor site probably null
R7040:Rpap3 UTSW 15 97679112 missense possibly damaging 0.51
R7429:Rpap3 UTSW 15 97688150 missense possibly damaging 0.96
R7430:Rpap3 UTSW 15 97688150 missense possibly damaging 0.96
R7829:Rpap3 UTSW 15 97681708 missense probably benign 0.02
R7853:Rpap3 UTSW 15 97678418 missense possibly damaging 0.92
R7936:Rpap3 UTSW 15 97678418 missense possibly damaging 0.92
YA93:Rpap3 UTSW 15 97693233 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CCTGAACTCTAACCTAGCACTG -3'
(R):5'- ACTCCATTAGGGCGAGAACATAG -3'

Sequencing Primer
(F):5'- CCTAGCACTGCTGCAAAAATAG -3'
(R):5'- TTAGGGCGAGAACATAGTATAACCAC -3'
Posted On2018-06-22