Incidental Mutation 'R6610:Ccnt1'
ID525931
Institutional Source Beutler Lab
Gene Symbol Ccnt1
Ensembl Gene ENSMUSG00000011960
Gene Namecyclin T1
Synonyms2810478G24Rik, CycT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6610 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98538689-98570923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98565101 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 63 (I63M)
Ref Sequence ENSEMBL: ENSMUSP00000130286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012104] [ENSMUST00000168928] [ENSMUST00000169707]
Predicted Effect probably benign
Transcript: ENSMUST00000012104
AA Change: I63M

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000012104
Gene: ENSMUSG00000011960
AA Change: I63M

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
SCOP:d1jkw_2 152 257 1e-24 SMART
Blast:CYCLIN 155 243 2e-54 BLAST
low complexity region 308 326 N/A INTRINSIC
coiled coil region 388 419 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
low complexity region 706 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164565
Predicted Effect probably damaging
Transcript: ENSMUST00000168928
AA Change: I63M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130286
Gene: ENSMUSG00000011960
AA Change: I63M

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
Blast:CYCLIN 155 182 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169707
AA Change: I63M

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126874
Gene: ENSMUSG00000011960
AA Change: I63M

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
SCOP:d1jkw_2 152 257 1e-24 SMART
Blast:CYCLIN 155 243 2e-54 BLAST
low complexity region 308 326 N/A INTRINSIC
coiled coil region 388 419 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
low complexity region 706 723 N/A INTRINSIC
Meta Mutation Damage Score 0.4957 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the highly conserved cyclin C subfamily. The encoded protein tightly associates with cyclin-dependent kinase 9, and is a major subunit of positive transcription elongation factor b (p-TEFb). In humans, there are multiple forms of positive transcription elongation factor b, which may include one of several different cyclins along with cyclin-dependent kinase 9. The complex containing the encoded cyclin and cyclin-dependent kinase 9 acts as a cofactor of human immunodeficiency virus type 1 (HIV-1) Tat protein, and is both necessary and sufficient for full activation of viral transcription. This cyclin and its kinase partner are also involved in triggering transcript elongation through phosphorylation of the carboxy-terminal domain of the largest RNA polymerase II subunit. Overexpression of this gene is implicated in tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Ccnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ccnt1 APN 15 98565109 missense possibly damaging 0.75
IGL00900:Ccnt1 APN 15 98554633 missense probably damaging 1.00
IGL01798:Ccnt1 APN 15 98544241 missense probably benign 0.00
IGL02126:Ccnt1 APN 15 98567603 missense probably damaging 1.00
IGL02341:Ccnt1 APN 15 98546783 missense possibly damaging 0.92
Lifecycle UTSW 15 98565124 nonsense probably null
R0049:Ccnt1 UTSW 15 98565079 missense probably benign 0.05
R0049:Ccnt1 UTSW 15 98565079 missense probably benign 0.05
R1116:Ccnt1 UTSW 15 98544338 missense probably damaging 1.00
R2063:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2065:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2066:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2068:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2180:Ccnt1 UTSW 15 98543600 missense possibly damaging 0.74
R3917:Ccnt1 UTSW 15 98544059 missense probably benign 0.00
R4805:Ccnt1 UTSW 15 98544308 missense probably benign 0.00
R4830:Ccnt1 UTSW 15 98543451 missense probably damaging 1.00
R4836:Ccnt1 UTSW 15 98567563 missense probably damaging 0.96
R5320:Ccnt1 UTSW 15 98544243 missense probably benign 0.35
R5740:Ccnt1 UTSW 15 98544500 missense probably benign 0.01
R5870:Ccnt1 UTSW 15 98543513 nonsense probably null
R6074:Ccnt1 UTSW 15 98543324 missense probably damaging 1.00
R6413:Ccnt1 UTSW 15 98543969 missense probably benign 0.01
R7260:Ccnt1 UTSW 15 98565124 nonsense probably null
R7752:Ccnt1 UTSW 15 98543916 missense probably benign 0.00
R7901:Ccnt1 UTSW 15 98543916 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTTGTCTTCTTACTCGGAAAGC -3'
(R):5'- TCATTAGAGAAGGAAACGAATCTGC -3'

Sequencing Primer
(F):5'- AGTAGGCAGCTACACTCA -3'
(R):5'- GGAAACGAATCTGCTGTTGG -3'
Posted On2018-06-22