Incidental Mutation 'R6610:Fopnl'
ID525933
Institutional Source Beutler Lab
Gene Symbol Fopnl
Ensembl Gene ENSMUSG00000022677
Gene NameFgfr1op N-terminal like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6610 (G1)
Quality Score217.468
Status Validated
Chromosome16
Chromosomal Location14299244-14317405 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TTGTG to TTG at 14300145 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023357] [ENSMUST00000120707]
Predicted Effect probably null
Transcript: ENSMUST00000023357
SMART Domains Protein: ENSMUSP00000023357
Gene: ENSMUSG00000022677

DomainStartEndE-ValueType
LisH 49 81 3.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120707
SMART Domains Protein: ENSMUSP00000113348
Gene: ENSMUSG00000022677

DomainStartEndE-ValueType
LisH 49 81 3.13e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230495
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Fopnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Fopnl APN 16 14304511 missense probably benign 0.00
IGL02422:Fopnl APN 16 14300206 missense probably benign 0.06
IGL02953:Fopnl APN 16 14304475 missense probably benign 0.09
R1459:Fopnl UTSW 16 14304516 missense possibly damaging 0.74
R1486:Fopnl UTSW 16 14300140 missense probably benign 0.17
R6399:Fopnl UTSW 16 14300145 frame shift probably null
R6609:Fopnl UTSW 16 14300145 frame shift probably null
R6612:Fopnl UTSW 16 14300145 frame shift probably null
R7382:Fopnl UTSW 16 14300145 frame shift probably null
R7383:Fopnl UTSW 16 14300145 frame shift probably null
R7487:Fopnl UTSW 16 14311104 missense probably benign 0.08
R8204:Fopnl UTSW 16 14300206 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATCAGCTTTCCACAGATGC -3'
(R):5'- TGCTTAAGACATGAGTAGAGTTCAC -3'

Sequencing Primer
(F):5'- TTTCCACAGATGCAGTAAACCATGAG -3'
(R):5'- CTGCATGCATGGTAGTACAGTAC -3'
Posted On2018-06-22