Incidental Mutation 'R6610:Grik1'
ID525935
Institutional Source Beutler Lab
Gene Symbol Grik1
Ensembl Gene ENSMUSG00000022935
Gene Nameglutamate receptor, ionotropic, kainate 1
SynonymsGlurbeta1, Glur5, D16Ium24e, Glur-5, D16Ium24, GluK5, A830007B11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6610 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location87895900-88290265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88034312 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 190 (I190T)
Ref Sequence ENSEMBL: ENSMUSP00000154130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023652] [ENSMUST00000072256] [ENSMUST00000114137] [ENSMUST00000211444] [ENSMUST00000227986] [ENSMUST00000228034] [ENSMUST00000228188]
Predicted Effect probably damaging
Transcript: ENSMUST00000023652
AA Change: I190T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023652
Gene: ENSMUSG00000022935
AA Change: I190T

DomainStartEndE-ValueType
Pfam:ANF_receptor 14 357 4.7e-69 PFAM
Pfam:Peripla_BP_6 48 347 5.1e-11 PFAM
PBPe 394 762 2.4e-130 SMART
Lig_chan-Glu_bd 404 468 6.34e-31 SMART
Blast:PBPe 770 815 2e-16 BLAST
low complexity region 829 850 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072256
AA Change: I190T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072107
Gene: ENSMUSG00000022935
AA Change: I190T

DomainStartEndE-ValueType
Pfam:ANF_receptor 14 357 2.6e-72 PFAM
Pfam:Peripla_BP_6 49 347 3.4e-10 PFAM
PBPe 394 762 2.4e-130 SMART
Lig_chan-Glu_bd 404 468 6.34e-31 SMART
Blast:PBPe 770 817 1e-17 BLAST
low complexity region 858 879 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114137
AA Change: I119T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109773
Gene: ENSMUSG00000022935
AA Change: I119T

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 325 5.4e-63 PFAM
Pfam:Peripla_BP_6 18 315 5.1e-11 PFAM
PBPe 362 730 2.4e-130 SMART
Lig_chan-Glu_bd 372 436 6.34e-31 SMART
Blast:PBPe 738 783 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210910
Predicted Effect probably damaging
Transcript: ENSMUST00000211444
AA Change: I190T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226447
Predicted Effect probably damaging
Transcript: ENSMUST00000227986
AA Change: I190T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228034
AA Change: I190T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228188
AA Change: I190T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5128 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to alter the properties of ion flow. Alternative splicing, resulting in transcript variants encoding different isoforms, has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display subtile abnormalities in the electrophysiology of neurons in the brain. Response to chemical pain stimuli is also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Grik1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Grik1 APN 16 87957600 splice site probably null
IGL01347:Grik1 APN 16 87957593 missense probably benign 0.00
IGL01612:Grik1 APN 16 87946735 missense probably damaging 1.00
IGL02010:Grik1 APN 16 88051508 missense possibly damaging 0.96
IGL02059:Grik1 APN 16 88056049 missense possibly damaging 0.95
IGL02068:Grik1 APN 16 87940651 missense possibly damaging 0.80
IGL02200:Grik1 APN 16 87940565 missense probably damaging 1.00
IGL02206:Grik1 APN 16 87935920 missense probably damaging 1.00
IGL02375:Grik1 APN 16 87946556 missense probably damaging 1.00
IGL02598:Grik1 APN 16 87947984 missense probably damaging 1.00
IGL02686:Grik1 APN 16 88009761 splice site probably null
IGL02890:Grik1 APN 16 87896802 intron probably benign
R0096:Grik1 UTSW 16 88034226 missense possibly damaging 0.55
R0096:Grik1 UTSW 16 88034226 missense possibly damaging 0.55
R0387:Grik1 UTSW 16 88034350 splice site probably benign
R0613:Grik1 UTSW 16 88051333 critical splice donor site probably null
R1087:Grik1 UTSW 16 88006377 missense probably benign 0.00
R1694:Grik1 UTSW 16 87950068 missense probably damaging 0.96
R1905:Grik1 UTSW 16 87896866 nonsense probably null
R1928:Grik1 UTSW 16 88051353 missense probably damaging 0.99
R2157:Grik1 UTSW 16 88056124 missense probably damaging 1.00
R3122:Grik1 UTSW 16 88006473 missense probably damaging 1.00
R3906:Grik1 UTSW 16 88006449 missense probably benign 0.00
R4194:Grik1 UTSW 16 87946728 missense probably benign 0.45
R4343:Grik1 UTSW 16 87896252 missense probably benign 0.00
R4349:Grik1 UTSW 16 87957543 missense probably damaging 1.00
R4416:Grik1 UTSW 16 88051461 missense probably benign 0.00
R4423:Grik1 UTSW 16 87923200 missense probably benign 0.10
R4660:Grik1 UTSW 16 87923131 missense probably damaging 1.00
R4804:Grik1 UTSW 16 87957569 missense probably damaging 0.99
R5052:Grik1 UTSW 16 87950098 missense probably benign 0.01
R5126:Grik1 UTSW 16 87947859 missense probably damaging 1.00
R5334:Grik1 UTSW 16 87923194 frame shift probably null
R5335:Grik1 UTSW 16 87923194 frame shift probably null
R5337:Grik1 UTSW 16 87923194 frame shift probably null
R5479:Grik1 UTSW 16 87936026 missense probably damaging 1.00
R6141:Grik1 UTSW 16 87896872 missense probably benign 0.00
R6188:Grik1 UTSW 16 88056071 missense probably benign 0.06
R6335:Grik1 UTSW 16 87947906 missense probably damaging 1.00
R6737:Grik1 UTSW 16 88051391 missense probably damaging 1.00
R7275:Grik1 UTSW 16 87912820 missense probably benign 0.06
R7876:Grik1 UTSW 16 87923233 missense
R8021:Grik1 UTSW 16 87914222 missense
R8027:Grik1 UTSW 16 87936005 missense
R8096:Grik1 UTSW 16 88006467 missense
R8266:Grik1 UTSW 16 87947979 missense probably benign
RF016:Grik1 UTSW 16 88034186 missense
RF022:Grik1 UTSW 16 87896337 missense
X0018:Grik1 UTSW 16 87946596 missense probably damaging 1.00
Z1177:Grik1 UTSW 16 87946684 missense
Predicted Primers PCR Primer
(F):5'- CGCTAAACCTCTTACCTGCTTAAG -3'
(R):5'- CCCTTGGAAACATTGTGCTTCC -3'

Sequencing Primer
(F):5'- GCTTAAGAATTTCAGCAGCCGTC -3'
(R):5'- GGAAACATTGTGCTTCCAAGTCAC -3'
Posted On2018-06-22