Incidental Mutation 'R6610:Cyp2c23'
List |< first << previous [record 14 of 47] next >> last >|
ID525945
Institutional Source Beutler Lab
Gene Symbol Cyp2c23
Ensembl Gene ENSMUSG00000025197
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 23
SynonymsCyp2c44
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6610 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location44005022-44029208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44007081 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 416 (F416L)
Ref Sequence ENSEMBL: ENSMUSP00000148377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026211] [ENSMUST00000211830]
Predicted Effect probably damaging
Transcript: ENSMUST00000026211
AA Change: F416L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026211
Gene: ENSMUSG00000025197
AA Change: F416L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 34 491 2.1e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211830
AA Change: F416L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele show reduced proliferative and tubulogenic responses in lung endothelial cells, decreased tumor angiogenesis and growth of induced tumors, and high potassium-induced hypertension with decreased urinary sodium excretion and increased plasma sodium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Cyp2c23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Cyp2c23 APN 19 44015073 missense possibly damaging 0.94
IGL01642:Cyp2c23 APN 19 44005556 missense probably damaging 1.00
IGL01782:Cyp2c23 APN 19 44029115 missense possibly damaging 0.77
IGL01843:Cyp2c23 APN 19 44005607 missense probably benign 0.02
IGL02902:Cyp2c23 APN 19 44021558 splice site probably benign
IGL03382:Cyp2c23 APN 19 44014932 missense probably damaging 0.99
R0196:Cyp2c23 UTSW 19 44012356 missense probably damaging 0.98
R0735:Cyp2c23 UTSW 19 44016810 missense probably damaging 1.00
R1384:Cyp2c23 UTSW 19 44013663 missense probably damaging 1.00
R1495:Cyp2c23 UTSW 19 44005508 missense probably benign 0.07
R1809:Cyp2c23 UTSW 19 44021558 splice site probably benign
R1872:Cyp2c23 UTSW 19 44005551 nonsense probably null
R2866:Cyp2c23 UTSW 19 44005446 missense probably damaging 1.00
R3801:Cyp2c23 UTSW 19 44007039 missense probably benign 0.11
R4234:Cyp2c23 UTSW 19 44029165 missense unknown
R4748:Cyp2c23 UTSW 19 44016737 splice site probably null
R4948:Cyp2c23 UTSW 19 44021699 missense possibly damaging 0.49
R5101:Cyp2c23 UTSW 19 44029183 missense unknown
R5420:Cyp2c23 UTSW 19 44015664 critical splice donor site probably null
R5770:Cyp2c23 UTSW 19 44021579 missense probably damaging 0.99
R5993:Cyp2c23 UTSW 19 44012360 missense probably damaging 1.00
R6254:Cyp2c23 UTSW 19 44005463 missense probably benign 0.03
R6269:Cyp2c23 UTSW 19 44029187 start codon destroyed unknown
R7344:Cyp2c23 UTSW 19 44021737 splice site probably null
R7603:Cyp2c23 UTSW 19 44014930 missense probably damaging 1.00
R8054:Cyp2c23 UTSW 19 44007116 missense probably damaging 0.99
R8098:Cyp2c23 UTSW 19 44015803 missense probably benign 0.29
R8157:Cyp2c23 UTSW 19 44021627 missense probably benign 0.00
X0065:Cyp2c23 UTSW 19 44029171 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAATGTCTCTAGCTAGACTTGGG -3'
(R):5'- TAGCAGCAGTAACCCGAGAC -3'

Sequencing Primer
(F):5'- CTTGGGAAGTTAGAACAGTTCGATC -3'
(R):5'- ACAGCCAGGGACTATGTGAGTATTTC -3'
Posted On2018-06-22