Incidental Mutation 'R6644:Fam168b'
ID525970
Institutional Source Beutler Lab
Gene Symbol Fam168b
Ensembl Gene ENSMUSG00000037503
Gene Namefamily with sequence similarity 168, member B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location34813219-34843065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34836741 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 21 (G21V)
Ref Sequence ENSEMBL: ENSMUSP00000139456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047534] [ENSMUST00000167518] [ENSMUST00000170092] [ENSMUST00000185231] [ENSMUST00000185469] [ENSMUST00000191307]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047534
AA Change: G21V

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042212
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 194 1e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140534
Predicted Effect probably damaging
Transcript: ENSMUST00000167518
AA Change: G21V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131720
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 62 3.3e-26 PFAM
Pfam:TCRP1 54 206 1.1e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170092
AA Change: G21V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128676
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 201 8.8e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185231
AA Change: G21V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139456
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 90 7.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185279
Predicted Effect probably damaging
Transcript: ENSMUST00000185469
AA Change: G21V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141150
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 66 3.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191307
AA Change: G21V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140573
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 206 2.8e-108 PFAM
Meta Mutation Damage Score 0.3811 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Fam168b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Fam168b APN 1 34836802 start codon destroyed probably null 0.58
R0207:Fam168b UTSW 1 34819688 missense probably damaging 0.98
R2008:Fam168b UTSW 1 34819865 critical splice donor site probably null
R4020:Fam168b UTSW 1 34828779 missense possibly damaging 0.71
R4617:Fam168b UTSW 1 34819982 missense possibly damaging 0.90
R5154:Fam168b UTSW 1 34818099 missense possibly damaging 0.83
R6167:Fam168b UTSW 1 34819603 missense probably damaging 1.00
R6600:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6602:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6603:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6627:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6628:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6692:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6705:Fam168b UTSW 1 34828783 missense probably damaging 0.98
R6985:Fam168b UTSW 1 34819708 missense probably damaging 1.00
R7387:Fam168b UTSW 1 34819708 missense probably damaging 1.00
Z1177:Fam168b UTSW 1 34819882 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCAGTTTGCCCACTGTCTTAAG -3'
(R):5'- GGAGCAGCAGAAAATACTTTGC -3'

Sequencing Primer
(F):5'- GGTAAAACACTGTTGCCTGC -3'
(R):5'- GCAGCAGAAAATACTTTGCTTTATAG -3'
Posted On2018-06-22