Incidental Mutation 'R6644:Zbtb37'
ID525979
Institutional Source Beutler Lab
Gene Symbol Zbtb37
Ensembl Gene ENSMUSG00000043467
Gene Namezinc finger and BTB domain containing 37
SynonymsD430004I08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location161002922-161034849 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 161032073 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 221 (Q221*)
Ref Sequence ENSEMBL: ENSMUSP00000131576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159250] [ENSMUST00000160056] [ENSMUST00000162226] [ENSMUST00000163079] [ENSMUST00000171748] [ENSMUST00000172044] [ENSMUST00000177003]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000065709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159157
Predicted Effect probably null
Transcript: ENSMUST00000159250
AA Change: Q221*
SMART Domains Protein: ENSMUSP00000125417
Gene: ENSMUSG00000043467
AA Change: Q221*

DomainStartEndE-ValueType
BTB 34 128 1.39e-23 SMART
ZnF_C2H2 375 397 5.99e-4 SMART
ZnF_C2H2 403 425 6.88e-4 SMART
ZnF_C2H2 431 454 1.16e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159438
Predicted Effect probably null
Transcript: ENSMUST00000160056
AA Change: Q221*
SMART Domains Protein: ENSMUSP00000134769
Gene: ENSMUSG00000043467
AA Change: Q221*

DomainStartEndE-ValueType
BTB 34 128 1.39e-23 SMART
ZnF_C2H2 375 397 5.99e-4 SMART
ZnF_C2H2 403 425 6.88e-4 SMART
ZnF_C2H2 431 454 1.16e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162226
AA Change: Q221*
SMART Domains Protein: ENSMUSP00000125253
Gene: ENSMUSG00000043467
AA Change: Q221*

DomainStartEndE-ValueType
BTB 34 128 1.39e-23 SMART
ZnF_C2H2 375 397 5.99e-4 SMART
ZnF_C2H2 403 425 6.88e-4 SMART
ZnF_C2H2 431 454 1.16e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163079
AA Change: Q221*
SMART Domains Protein: ENSMUSP00000134753
Gene: ENSMUSG00000043467
AA Change: Q221*

DomainStartEndE-ValueType
BTB 34 128 1.39e-23 SMART
ZnF_C2H2 375 397 5.99e-4 SMART
ZnF_C2H2 403 425 6.88e-4 SMART
ZnF_C2H2 431 454 1.16e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171748
AA Change: Q221*
SMART Domains Protein: ENSMUSP00000129965
Gene: ENSMUSG00000043467
AA Change: Q221*

DomainStartEndE-ValueType
BTB 34 128 1.39e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000172044
AA Change: Q221*
SMART Domains Protein: ENSMUSP00000131576
Gene: ENSMUSG00000043467
AA Change: Q221*

DomainStartEndE-ValueType
BTB 34 128 1.39e-23 SMART
ZnF_C2H2 375 397 5.99e-4 SMART
ZnF_C2H2 403 425 6.88e-4 SMART
ZnF_C2H2 431 454 1.16e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159663
Predicted Effect probably benign
Transcript: ENSMUST00000177003
SMART Domains Protein: ENSMUSP00000134816
Gene: ENSMUSG00000043467

DomainStartEndE-ValueType
BTB 34 99 1.31e-1 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Zbtb37
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0241:Zbtb37 UTSW 1 161020369 missense probably benign
R0241:Zbtb37 UTSW 1 161020369 missense probably benign
R0330:Zbtb37 UTSW 1 161032496 missense probably benign 0.01
R0442:Zbtb37 UTSW 1 161032348 missense possibly damaging 0.51
R1370:Zbtb37 UTSW 1 161032022 missense probably benign 0.32
R1716:Zbtb37 UTSW 1 161020244 missense probably benign 0.07
R7257:Zbtb37 UTSW 1 161032661 missense probably damaging 1.00
R7718:Zbtb37 UTSW 1 161032232 missense possibly damaging 0.90
R7934:Zbtb37 UTSW 1 161029735 missense probably damaging 1.00
R8145:Zbtb37 UTSW 1 161020084 missense probably damaging 0.98
Z1177:Zbtb37 UTSW 1 161029665 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ATGGCCTGTGGTGTCAATCAC -3'
(R):5'- AGACCTCCAGAGTCTCATAGGG -3'

Sequencing Primer
(F):5'- GTGTCAATCACCATGGCTGTGAC -3'
(R):5'- TCCAGAGTCTCATAGGGCTACAC -3'
Posted On2018-06-22