Incidental Mutation 'R6644:Ifi211'
ID525981
Institutional Source Beutler Lab
Gene Symbol Ifi211
Ensembl Gene ENSMUSG00000026536
Gene Nameinterferon activated gene 211
SynonymsIfi205b, Mnda
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173896345-173913046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 173905552 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 181 (C181Y)
Ref Sequence ENSEMBL: ENSMUSP00000009340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009340] [ENSMUST00000111210]
PDB Structure
Solution structures of the PAAD_DAPIN domain of mus musculus interferon-activatable protein 205 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000009340
AA Change: C181Y

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000009340
Gene: ENSMUSG00000026536
AA Change: C181Y

DomainStartEndE-ValueType
PYRIN 6 84 1.94e-14 SMART
low complexity region 120 154 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:HIN 225 393 2.2e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the interferon-regulated 200 family of proteins, which contain an N-terminal pyrin domain that is proposed to function in cell death and a partially conserved 220 amino acid domain. Expression of this protein in embryonic stem cells is critical for the DNA damage response and regulation of cell survival. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Ifi211
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03258:Ifi211 APN 1 173905532 missense probably benign 0.40
IGL03304:Ifi211 APN 1 173907707 missense probably damaging 1.00
BB007:Ifi211 UTSW 1 173906203 missense possibly damaging 0.91
BB017:Ifi211 UTSW 1 173906203 missense possibly damaging 0.91
FR4548:Ifi211 UTSW 1 173906193 missense possibly damaging 0.85
R1686:Ifi211 UTSW 1 173899403 missense probably damaging 0.99
R2011:Ifi211 UTSW 1 173907603 missense probably damaging 0.99
R4657:Ifi211 UTSW 1 173907660 missense probably benign 0.03
R5220:Ifi211 UTSW 1 173907696 missense probably damaging 1.00
R5410:Ifi211 UTSW 1 173906263 missense probably benign 0.08
R6953:Ifi211 UTSW 1 173906266 missense probably damaging 1.00
R7451:Ifi211 UTSW 1 173899492 missense probably damaging 1.00
R7567:Ifi211 UTSW 1 173901835 missense probably damaging 1.00
R7667:Ifi211 UTSW 1 173899454 missense probably damaging 1.00
R7930:Ifi211 UTSW 1 173906203 missense possibly damaging 0.91
Z1088:Ifi211 UTSW 1 173907660 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTAATTAAACCTCAGGGAGAAGTGG -3'
(R):5'- AGTTTAGACCTGGCCAGAGG -3'

Sequencing Primer
(F):5'- GGGGGACATGGTCAGAATTTC -3'
(R):5'- GTGGGTGCTACTCCTTCAAG -3'
Posted On2018-06-22