Incidental Mutation 'R6644:Olfr1221'
ID525985
Institutional Source Beutler Lab
Gene Symbol Olfr1221
Ensembl Gene ENSMUSG00000075102
Gene Nameolfactory receptor 1221
SynonymsGA_x6K02T2Q125-50591144-50590209, MOR233-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89109086-89117283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89111981 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 177 (M177T)
Ref Sequence ENSEMBL: ENSMUSP00000149330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099795] [ENSMUST00000143255] [ENSMUST00000213404] [ENSMUST00000217635]
Predicted Effect probably benign
Transcript: ENSMUST00000099795
AA Change: M177T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097383
Gene: ENSMUSG00000075102
AA Change: M177T

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.6e-48 PFAM
Pfam:7tm_1 39 302 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143255
AA Change: M177T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000213404
AA Change: M177T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000217635
AA Change: M177T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Olfr1221
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Olfr1221 APN 2 89111679 missense probably benign 0.19
IGL01965:Olfr1221 APN 2 89112191 missense probably benign 0.37
IGL02645:Olfr1221 APN 2 89111619 missense probably benign 0.00
PIT4354001:Olfr1221 UTSW 2 89112486 nonsense probably null
R0124:Olfr1221 UTSW 2 89111744 missense possibly damaging 0.56
R0940:Olfr1221 UTSW 2 89112075 missense probably benign
R3689:Olfr1221 UTSW 2 89112042 missense possibly damaging 0.85
R4489:Olfr1221 UTSW 2 89111572 splice site probably null
R4706:Olfr1221 UTSW 2 89112232 missense probably damaging 0.98
R4707:Olfr1221 UTSW 2 89112232 missense probably damaging 0.98
R5133:Olfr1221 UTSW 2 89111796 splice site probably null
R6629:Olfr1221 UTSW 2 89112162 missense probably benign 0.09
R6723:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6725:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6754:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6765:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6766:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R7215:Olfr1221 UTSW 2 89112501 nonsense probably null
R7562:Olfr1221 UTSW 2 89112285 missense probably benign 0.00
R7681:Olfr1221 UTSW 2 89111591 missense probably benign 0.00
R7981:Olfr1221 UTSW 2 89112056 missense probably damaging 1.00
R8318:Olfr1221 UTSW 2 89111898 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGACTGTAATATGGGACCCACAG -3'
(R):5'- TGTACTGTCAGCTATGGCCTATG -3'

Sequencing Primer
(F):5'- GGAGAGAGCTTTATATCGCCC -3'
(R):5'- CAGCTATGGCCTATGACCGTTATG -3'
Posted On2018-06-22