Incidental Mutation 'R6596:Rasgrf1'
ID 525986
Institutional Source Beutler Lab
Gene Symbol Rasgrf1
Ensembl Gene ENSMUSG00000032356
Gene Name RAS protein-specific guanine nucleotide-releasing factor 1
Synonyms Grf1, CDC25Mm, Grfbeta, CDC25
MMRRC Submission 044720-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6596 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 89791961-89909030 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89894847 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 1089 (N1089I)
Ref Sequence ENSEMBL: ENSMUSP00000034912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034912]
AlphaFold P27671
PDB Structure Crystal Structure of the Cdc25 domain of RasGRF1 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034912
AA Change: N1089I

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034912
Gene: ENSMUSG00000032356
AA Change: N1089I

DomainStartEndE-ValueType
PH 23 132 2.48e-18 SMART
Blast:RhoGEF 146 196 4e-6 BLAST
IQ 205 227 5.27e0 SMART
RhoGEF 248 429 1.96e-57 SMART
PH 461 590 1.51e-8 SMART
RasGEFN 634 767 3.07e-10 SMART
low complexity region 844 855 N/A INTRINSIC
RasGEFN 869 997 5.86e-7 SMART
RasGEF 1023 1260 1.85e-99 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) similar to the Saccharomyces cerevisiae CDC25 gene product. Functional analysis has demonstrated that this protein stimulates the dissociation of GDP from RAS protein. The studies of the similar gene in mouse suggested that the Ras-GEF activity of this protein in brain can be activated by Ca2+ influx, muscarinic receptors, and G protein beta-gamma subunit. Mouse studies also indicated that the Ras-GEF signaling pathway mediated by this protein may be important for long-term memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for null mutations (and heterozygotes with a paternally inherited mutant allele) exhibit reduced postnatal growth, low insulin and IGF I levels, glucose intolerance, beta-cell hypoplasia, impaired long-term synaptic plasticity, and impaired hippocampal-dependent learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,819,984 (GRCm39) C135S possibly damaging Het
Bag4 C T 8: 26,259,528 (GRCm39) D224N probably damaging Het
Cldn15 T A 5: 137,003,533 (GRCm39) C178* probably null Het
Col7a1 C A 9: 108,783,409 (GRCm39) probably benign Het
Crnn G A 3: 93,054,182 (GRCm39) E22K probably damaging Het
Dcstamp A C 15: 39,617,605 (GRCm39) T5P possibly damaging Het
Dennd4a A G 9: 64,759,702 (GRCm39) Y269C probably damaging Het
Dsg1c T A 18: 20,403,581 (GRCm39) probably null Het
Duox2 C T 2: 122,115,819 (GRCm39) V972I probably benign Het
Eif1ad15 C A 12: 88,288,057 (GRCm39) L65F possibly damaging Het
Ephb1 A C 9: 102,072,001 (GRCm39) Y259* probably null Het
Fam149a G T 8: 45,834,667 (GRCm39) T44K probably benign Het
Fn1 A G 1: 71,648,641 (GRCm39) Y1423H probably damaging Het
Garem1 T A 18: 21,281,796 (GRCm39) I187F probably damaging Het
Gfm2 C T 13: 97,301,657 (GRCm39) P487S probably damaging Het
Hyou1 A G 9: 44,299,052 (GRCm39) E625G probably benign Het
Kmt5a G A 5: 124,588,759 (GRCm39) V121M probably benign Het
Mindy4 T C 6: 55,201,001 (GRCm39) S229P probably damaging Het
Muc16 T C 9: 18,478,011 (GRCm39) D7098G probably benign Het
Nsf A T 11: 103,801,283 (GRCm39) I244N probably damaging Het
Obox1 C T 7: 15,289,301 (GRCm39) S72L probably damaging Het
Or4b1 T A 2: 89,979,622 (GRCm39) T243S possibly damaging Het
Or5d38 C T 2: 87,954,543 (GRCm39) C262Y probably damaging Het
Pcdhb7 A T 18: 37,476,414 (GRCm39) I517F probably damaging Het
Plk2 C T 13: 110,534,296 (GRCm39) A292V probably benign Het
Pomgnt2 T C 9: 121,811,320 (GRCm39) E487G possibly damaging Het
Robo2 T A 16: 73,767,996 (GRCm39) N603Y probably damaging Het
Slc35f4 G A 14: 49,763,057 (GRCm39) A5V probably damaging Het
Smc4 A T 3: 68,933,226 (GRCm39) I616F probably damaging Het
Sorl1 T G 9: 41,912,899 (GRCm39) N1361H possibly damaging Het
Syngr1 C T 15: 79,995,893 (GRCm39) T144M probably damaging Het
Tbc1d16 A C 11: 119,048,601 (GRCm39) W351G probably damaging Het
Tbx15 A G 3: 99,259,508 (GRCm39) S460G probably benign Het
Tns2 G A 15: 102,018,994 (GRCm39) R395Q probably benign Het
Tpte T C 8: 22,823,285 (GRCm39) L304P probably damaging Het
Tubgcp5 T A 7: 55,456,382 (GRCm39) F325I probably benign Het
Ucp3 A T 7: 100,131,140 (GRCm39) I198F probably benign Het
Vit T C 17: 78,930,274 (GRCm39) V413A probably benign Het
Xrcc6 T C 15: 81,907,155 (GRCm39) M1T probably null Het
Other mutations in Rasgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Rasgrf1 APN 9 89,852,534 (GRCm39) missense probably damaging 1.00
IGL00763:Rasgrf1 APN 9 89,853,073 (GRCm39) missense probably benign 0.05
IGL01336:Rasgrf1 APN 9 89,873,583 (GRCm39) missense probably benign 0.00
IGL01710:Rasgrf1 APN 9 89,873,745 (GRCm39) missense probably benign 0.18
IGL01807:Rasgrf1 APN 9 89,873,566 (GRCm39) missense probably damaging 0.99
IGL01939:Rasgrf1 APN 9 89,856,889 (GRCm39) missense probably damaging 0.99
IGL02453:Rasgrf1 APN 9 89,826,813 (GRCm39) missense possibly damaging 0.76
IGL02961:Rasgrf1 APN 9 89,863,702 (GRCm39) missense possibly damaging 0.88
IGL03009:Rasgrf1 APN 9 89,873,756 (GRCm39) missense possibly damaging 0.75
IGL03369:Rasgrf1 APN 9 89,892,504 (GRCm39) missense probably damaging 1.00
IGL03373:Rasgrf1 APN 9 89,899,084 (GRCm39) splice site probably benign
Malenkiy UTSW 9 89,892,537 (GRCm39) splice site probably null
Pigeon UTSW 9 89,849,968 (GRCm39) missense probably damaging 1.00
PIT4142001:Rasgrf1 UTSW 9 89,797,626 (GRCm39) missense possibly damaging 0.91
R0234:Rasgrf1 UTSW 9 89,891,419 (GRCm39) missense probably damaging 1.00
R0629:Rasgrf1 UTSW 9 89,866,322 (GRCm39) missense probably damaging 1.00
R0685:Rasgrf1 UTSW 9 89,797,535 (GRCm39) utr 3 prime probably benign
R0730:Rasgrf1 UTSW 9 89,833,062 (GRCm39) splice site probably benign
R0835:Rasgrf1 UTSW 9 89,882,824 (GRCm39) missense probably benign
R1432:Rasgrf1 UTSW 9 89,894,853 (GRCm39) missense probably benign 0.35
R1647:Rasgrf1 UTSW 9 89,835,973 (GRCm39) missense probably benign 0.28
R1717:Rasgrf1 UTSW 9 89,835,966 (GRCm39) missense probably damaging 0.98
R1933:Rasgrf1 UTSW 9 89,835,966 (GRCm39) missense probably damaging 0.98
R1934:Rasgrf1 UTSW 9 89,835,966 (GRCm39) missense probably damaging 0.98
R2187:Rasgrf1 UTSW 9 89,876,888 (GRCm39) missense possibly damaging 0.93
R2240:Rasgrf1 UTSW 9 89,858,815 (GRCm39) missense probably damaging 0.99
R2940:Rasgrf1 UTSW 9 89,873,767 (GRCm39) missense possibly damaging 0.84
R3949:Rasgrf1 UTSW 9 89,863,797 (GRCm39) splice site probably benign
R4751:Rasgrf1 UTSW 9 89,894,919 (GRCm39) missense probably damaging 1.00
R4751:Rasgrf1 UTSW 9 89,792,171 (GRCm39) missense probably damaging 1.00
R4901:Rasgrf1 UTSW 9 89,877,056 (GRCm39) missense probably benign 0.00
R4910:Rasgrf1 UTSW 9 89,858,805 (GRCm39) missense probably benign 0.00
R4961:Rasgrf1 UTSW 9 89,826,922 (GRCm39) missense probably benign 0.06
R5270:Rasgrf1 UTSW 9 89,908,747 (GRCm39) missense probably benign 0.00
R5320:Rasgrf1 UTSW 9 89,902,478 (GRCm39) missense probably damaging 0.99
R5602:Rasgrf1 UTSW 9 89,793,624 (GRCm39) missense possibly damaging 0.73
R5659:Rasgrf1 UTSW 9 89,866,342 (GRCm39) missense probably damaging 1.00
R5960:Rasgrf1 UTSW 9 89,903,437 (GRCm39) missense possibly damaging 0.69
R6074:Rasgrf1 UTSW 9 89,835,968 (GRCm39) missense probably benign 0.01
R6400:Rasgrf1 UTSW 9 89,873,683 (GRCm39) missense probably damaging 1.00
R6603:Rasgrf1 UTSW 9 89,792,310 (GRCm39) missense probably damaging 0.96
R6647:Rasgrf1 UTSW 9 89,892,516 (GRCm39) missense probably benign 0.00
R6813:Rasgrf1 UTSW 9 89,892,537 (GRCm39) splice site probably null
R7136:Rasgrf1 UTSW 9 89,873,651 (GRCm39) missense probably damaging 1.00
R7155:Rasgrf1 UTSW 9 89,884,414 (GRCm39) missense possibly damaging 0.90
R7175:Rasgrf1 UTSW 9 89,862,802 (GRCm39) missense probably benign 0.02
R7202:Rasgrf1 UTSW 9 89,899,125 (GRCm39) missense possibly damaging 0.49
R7219:Rasgrf1 UTSW 9 89,866,341 (GRCm39) missense probably damaging 1.00
R7244:Rasgrf1 UTSW 9 89,876,810 (GRCm39) missense probably damaging 1.00
R7733:Rasgrf1 UTSW 9 89,863,780 (GRCm39) missense probably benign 0.01
R7764:Rasgrf1 UTSW 9 89,876,747 (GRCm39) missense possibly damaging 0.94
R8210:Rasgrf1 UTSW 9 89,793,675 (GRCm39) missense unknown
R8421:Rasgrf1 UTSW 9 89,849,968 (GRCm39) missense probably damaging 1.00
R8524:Rasgrf1 UTSW 9 89,797,638 (GRCm39) missense possibly damaging 0.53
R8526:Rasgrf1 UTSW 9 89,856,901 (GRCm39) missense probably damaging 0.96
R8697:Rasgrf1 UTSW 9 89,877,055 (GRCm39) missense probably benign
R9133:Rasgrf1 UTSW 9 89,793,600 (GRCm39) missense probably benign
R9153:Rasgrf1 UTSW 9 89,826,790 (GRCm39) missense probably damaging 1.00
R9191:Rasgrf1 UTSW 9 89,883,923 (GRCm39) missense probably damaging 1.00
R9349:Rasgrf1 UTSW 9 89,884,460 (GRCm39) missense probably damaging 0.99
R9468:Rasgrf1 UTSW 9 89,880,756 (GRCm39) missense probably benign 0.00
R9498:Rasgrf1 UTSW 9 89,826,921 (GRCm39) missense probably benign
R9747:Rasgrf1 UTSW 9 89,877,047 (GRCm39) missense probably benign
R9779:Rasgrf1 UTSW 9 89,873,551 (GRCm39) missense probably damaging 0.99
Z1177:Rasgrf1 UTSW 9 89,832,970 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTAATTTATAGGGCAATGTCTCC -3'
(R):5'- CTGGAAATCTGAACCCTCTGC -3'

Sequencing Primer
(F):5'- GGCAATGTCTCCTTTTTATATTAAGC -3'
(R):5'- AGCAGTGCCAGCTTTCTG -3'
Posted On 2018-06-22