Incidental Mutation 'R6644:Cryba4'
ID525995
Institutional Source Beutler Lab
Gene Symbol Cryba4
Ensembl Gene ENSMUSG00000066975
Gene Namecrystallin, beta A4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location112246493-112252518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112246762 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 167 (D167G)
Ref Sequence ENSEMBL: ENSMUSP00000108004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086629] [ENSMUST00000112383] [ENSMUST00000112385]
Predicted Effect probably damaging
Transcript: ENSMUST00000086629
AA Change: D167G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083826
Gene: ENSMUSG00000066975
AA Change: D167G

DomainStartEndE-ValueType
XTALbg 13 97 1.08e-37 SMART
XTALbg 106 194 2.59e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112383
AA Change: D154G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108002
Gene: ENSMUSG00000066975
AA Change: D154G

DomainStartEndE-ValueType
XTALbg 1 84 1.71e-35 SMART
XTALbg 93 181 2.59e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112385
AA Change: D167G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108004
Gene: ENSMUSG00000066975
AA Change: D167G

DomainStartEndE-ValueType
XTALbg 13 97 1.08e-37 SMART
XTALbg 106 194 2.59e-35 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a member of the crystallin family of proteins that contribute to the transparency and refractive properties of the ocular lens. Certain mutations in the human ortholog of this gene are associated with cataract and bilateral microphthalmia. This gene is located adjacent to a related crystallin gene on chromosome 5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Cryba4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Cryba4 APN 5 112251009 unclassified probably benign
R0741:Cryba4 UTSW 5 112246688 missense probably damaging 1.00
R5622:Cryba4 UTSW 5 112251124 missense probably damaging 1.00
R5811:Cryba4 UTSW 5 112251071 missense probably benign
R7008:Cryba4 UTSW 5 112251782 missense probably benign
R7554:Cryba4 UTSW 5 112251103 missense probably damaging 0.99
R7556:Cryba4 UTSW 5 112251103 missense probably damaging 0.99
R7671:Cryba4 UTSW 5 112248173 critical splice donor site probably null
R7888:Cryba4 UTSW 5 112251052 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCCAGAGGACACAAGGGTAG -3'
(R):5'- CCCTAAAGAACAGCCTTGGG -3'

Sequencing Primer
(F):5'- GACACAAGGGTAGCCAGAACC -3'
(R):5'- TGGAGCTTCCATACGTGC -3'
Posted On2018-06-22