Mutagenetix > Incidental Mutation

Incidental Mutation 'R6644:Trim34a'

526001

Institutional Source

Beutler Lab

Gene Symbol

Trim34a

Ensembl Gene

ENSMUSG00000056144

Gene Name

tripartite motif-containing 34A

Synonyms

Trim34-1, Trim34

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R6644 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104244457-104262234 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104261037 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 349 (Y349H)

Ref Sequence

ENSEMBL: ENSMUSP00000102462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051795] [ENSMUST00000060315] [ENSMUST00000098179] [ENSMUST00000106848] [ENSMUST00000106849]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000051795

SMART Domains

Protein: ENSMUSP00000050084
Gene: ENSMUSG00000060441

Domain	Start	End	E-Value	Type
RING	15	58	3.64e-7	SMART
BBOX	91	132	4.83e-12	SMART
coiled coil region	172	232	N/A	INTRINSIC
Pfam:SPRY	349	485	9.2e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000060315
AA Change: Y349H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000055058
Gene: ENSMUSG00000056144
AA Change: Y349H

Domain	Start	End	E-Value	Type
RING	15	58	6.79e-7	SMART
BBOX	91	132	1.08e-9	SMART
coiled coil region	194	238	N/A	INTRINSIC
Blast:PRY	299	343	2e-21	BLAST
Pfam:SPRY	347	474	1e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098179

SMART Domains

Protein: ENSMUSP00000095781
Gene: ENSMUSG00000060441

Domain	Start	End	E-Value	Type
RING	15	58	3.64e-7	SMART
BBOX	91	132	4.83e-12	SMART
Pfam:SPRY	351	493	1.6e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106848
AA Change: Y349H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102461
Gene: ENSMUSG00000056144
AA Change: Y349H

Domain	Start	End	E-Value	Type
RING	15	58	6.79e-7	SMART
BBOX	91	132	1.08e-9	SMART
coiled coil region	194	238	N/A	INTRINSIC
Blast:PRY	299	343	2e-21	BLAST
Pfam:SPRY	345	484	6.5e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106849
AA Change: Y349H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102462
Gene: ENSMUSG00000056144
AA Change: Y349H

Domain	Start	End	E-Value	Type
RING	15	58	6.79e-7	SMART
BBOX	91	132	1.08e-9	SMART
coiled coil region	194	238	N/A	INTRINSIC
Blast:PRY	299	343	2e-21	BLAST
Pfam:SPRY	345	484	6.5e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158033

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217156

Meta Mutation Damage Score

0.8011

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.3%

Validation Efficiency

100% (50/50)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,922	I130S	probably damaging	Het
Abca7	C	T	10: 80,008,764	P1461L	probably damaging	Het
Abhd14a	T	C	9: 106,444,273	Y10C	probably damaging	Het
Adcy2	C	T	13: 68,668,552	V772M	possibly damaging	Het
Apob	A	G	12: 8,009,077	M2487V	probably damaging	Het
B4galnt1	T	C	10: 127,171,793		probably null	Het
Cabp7	C	T	11: 4,740,396	V76I	probably benign	Het
Cbr3	A	G	16: 93,690,511	Y194C	probably damaging	Het
Cdk18	G	A	1: 132,122,069	Q58*	probably null	Het
Cryba4	T	C	5: 112,246,762	D167G	probably damaging	Het
Dner	T	C	1: 84,395,707	N588S	probably damaging	Het
Dnm1l	T	C	16: 16,329,873	I343V	probably benign	Het
Fam168b	C	A	1: 34,836,741	G21V	probably damaging	Het
Fam71d	T	A	12: 78,715,286	D241E	probably damaging	Het
Fbxw17	G	A	13: 50,423,219	R49Q	probably damaging	Het
Gm10332	T	A	14: 54,820,159	F59I	probably damaging	Het
Gm6803	A	G	12: 88,018,690	F28L	probably benign	Het
Gm8765	A	G	13: 50,702,035	T570A	possibly damaging	Het
Gnai3	A	G	3: 108,123,536		probably null	Het
Helz	T	A	11: 107,632,261	M75K	possibly damaging	Het
Hnrnph3	C	T	10: 63,018,893		probably benign	Het
Ifi211	C	T	1: 173,905,552	C181Y	probably benign	Het
Immp1l	A	G	2: 105,937,045	K83R	probably damaging	Het
Itga6	G	A	2: 71,841,124	G740R	probably damaging	Het
Klhl1	T	C	14: 96,517,918	T134A	probably benign	Het
Klhl7	A	G	5: 24,149,246	D353G	probably damaging	Het
Map3k1	A	G	13: 111,752,449	S1325P	probably benign	Het
Map3k4	A	G	17: 12,232,410		probably null	Het
Meioc	G	A	11: 102,668,460		probably null	Het
Mfap5	T	C	6: 122,520,596	F26L	probably damaging	Het
Myo5a	A	G	9: 75,146,967	T386A	probably damaging	Het
Npc1l1	A	T	11: 6,214,013	L1266Q	probably damaging	Het
Npc1l1	G	T	11: 6,214,014	L1266M	probably damaging	Het
Olfr1221	A	G	2: 89,111,981	M177T	probably benign	Het
Olfr612	C	A	7: 103,539,058	V59F	possibly damaging	Het
Pbld1	T	A	10: 63,075,063	S233T	probably damaging	Het
Phf12	A	G	11: 78,026,092	*789W	probably null	Het
Sf3b2	A	T	19: 5,279,964		probably null	Het
Slc23a3	A	G	1: 75,128,547	I459T	probably damaging	Het
Sptbn2	C	G	19: 4,749,012	R2037G	probably benign	Het
Stard9	A	C	2: 120,695,772	M837L	probably benign	Het
Stx5a	A	T	19: 8,755,248		probably benign	Het
Tmc7	A	G	7: 118,538,162	V719A	probably benign	Het
Trank1	T	A	9: 111,364,834	I642K	possibly damaging	Het
Uba7	A	G	9: 107,981,472	Y834C	possibly damaging	Het
Ube2d1	A	G	10: 71,256,700	S105P	possibly damaging	Het
Vps13a	A	G	19: 16,744,919	V343A	possibly damaging	Het
Zbtb37	G	A	1: 161,032,073	Q221*	probably null	Het
Zfp119b	T	C	17: 55,939,148	N346S	probably benign	Het
Zfp708	G	T	13: 67,070,721	T358K	possibly damaging	Het

Other mutations in Trim34a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Trim34a	APN	7	104261331	missense	probably damaging	1.00
IGL00826:Trim34a	APN	7	104260933	splice site	probably null
IGL01526:Trim34a	APN	7	104260499	missense	probably damaging	1.00
IGL01859:Trim34a	APN	7	104260942	missense	probably damaging	0.96
IGL02052:Trim34a	APN	7	104247831	missense	probably benign	0.33
IGL02192:Trim34a	APN	7	104247732	start codon destroyed	probably null	1.00
IGL02351:Trim34a	APN	7	104261234	nonsense	probably null
IGL02358:Trim34a	APN	7	104261234	nonsense	probably null
IGL03326:Trim34a	APN	7	104261380	missense	probably benign	0.03
IGL03366:Trim34a	APN	7	104260933	splice site	probably null
Gold_belt	UTSW	7	104261064	nonsense	probably null
PIT4472001:Trim34a	UTSW	7	104247948	missense	probably damaging	1.00
PIT4791001:Trim34a	UTSW	7	104260484	missense	probably benign	0.15
R0115:Trim34a	UTSW	7	104247902	missense	probably damaging	1.00
R0848:Trim34a	UTSW	7	104261124	missense	probably benign
R1016:Trim34a	UTSW	7	104247960	missense	probably benign	0.10
R1477:Trim34a	UTSW	7	104248080	missense	possibly damaging	0.81
R1622:Trim34a	UTSW	7	104261338	splice site	probably null
R2287:Trim34a	UTSW	7	104261055	missense	probably damaging	1.00
R3685:Trim34a	UTSW	7	104260126	splice site	probably null
R4166:Trim34a	UTSW	7	104261016	missense	probably benign	0.02
R4967:Trim34a	UTSW	7	104261064	nonsense	probably null
R4979:Trim34a	UTSW	7	104247862	missense	probably benign	0.00
R5194:Trim34a	UTSW	7	104260993	missense	possibly damaging	0.70
R5443:Trim34a	UTSW	7	104260213	missense	possibly damaging	0.80
R5631:Trim34a	UTSW	7	104248739	missense	probably damaging	1.00
R5902:Trim34a	UTSW	7	104261121	nonsense	probably null
R6147:Trim34a	UTSW	7	104261191	missense	probably damaging	0.99
R7971:Trim34a	UTSW	7	104247818	missense	probably damaging	0.98
R8060:Trim34a	UTSW	7	104260976	missense	probably damaging	1.00
R8278:Trim34a	UTSW	7	104249416	missense	probably damaging	0.99
R8356:Trim34a	UTSW	7	104260971	missense	probably damaging	0.99
R9275:Trim34a	UTSW	7	104260994	missense	probably damaging	0.96
R9563:Trim34a	UTSW	7	104261121	nonsense	probably null
X0023:Trim34a	UTSW	7	104259415	missense	probably benign	0.43

Predicted Primers

PCR Primer
(F):5'- CTCCAGTGTTGGCTTTTCACAG -3'
(R):5'- ACTTCGATCCATGCTGTAACCC -3'

Sequencing Primer
(F):5'- GGCTTTTCACAGTGTTTCACAAAC -3'
(R):5'- TGCTGTAACCCTATAACCCAGTAG -3'

Posted On

2018-06-22