Incidental Mutation 'R6644:Tmc7'
ID526003
Institutional Source Beutler Lab
Gene Symbol Tmc7
Ensembl Gene ENSMUSG00000042246
Gene Nametransmembrane channel-like gene family 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location118535841-118584736 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118538162 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 719 (V719A)
Ref Sequence ENSEMBL: ENSMUSP00000046927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032887] [ENSMUST00000044195] [ENSMUST00000098090] [ENSMUST00000209146]
Predicted Effect probably benign
Transcript: ENSMUST00000032887
SMART Domains Protein: ENSMUSP00000032887
Gene: ENSMUSG00000030652

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
Pfam:COQ7 48 217 3.5e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044195
AA Change: V719A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046927
Gene: ENSMUSG00000042246
AA Change: V719A

DomainStartEndE-ValueType
transmembrane domain 167 189 N/A INTRINSIC
transmembrane domain 216 238 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 402 424 N/A INTRINSIC
Pfam:TMC 484 595 5.2e-51 PFAM
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098090
SMART Domains Protein: ENSMUSP00000095695
Gene: ENSMUSG00000030652

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
Pfam:COQ7 48 210 5.9e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127700
Predicted Effect probably benign
Transcript: ENSMUST00000209146
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Tmc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Tmc7 APN 7 118552762 missense probably damaging 1.00
IGL01456:Tmc7 APN 7 118547310 splice site probably benign
IGL01784:Tmc7 APN 7 118547315 critical splice donor site probably null
IGL02158:Tmc7 APN 7 118538211 missense probably damaging 1.00
PIT4403001:Tmc7 UTSW 7 118547400 missense probably benign 0.04
PIT4403001:Tmc7 UTSW 7 118547401 missense possibly damaging 0.86
PIT4696001:Tmc7 UTSW 7 118564343 missense probably benign 0.04
R1164:Tmc7 UTSW 7 118542024 missense probably benign 0.01
R1169:Tmc7 UTSW 7 118551260 missense probably benign 0.00
R1170:Tmc7 UTSW 7 118551260 missense probably benign 0.00
R1420:Tmc7 UTSW 7 118566217 nonsense probably null
R1885:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1886:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1887:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1923:Tmc7 UTSW 7 118545627 missense probably benign 0.08
R2220:Tmc7 UTSW 7 118552816 missense possibly damaging 0.87
R4858:Tmc7 UTSW 7 118543342 missense probably damaging 1.00
R5000:Tmc7 UTSW 7 118558854 critical splice donor site probably null
R5038:Tmc7 UTSW 7 118543365 missense probably damaging 1.00
R5075:Tmc7 UTSW 7 118552696 critical splice donor site probably null
R5272:Tmc7 UTSW 7 118561053 missense probably benign
R5691:Tmc7 UTSW 7 118541893 missense probably benign
R5800:Tmc7 UTSW 7 118539440 missense probably benign
R5889:Tmc7 UTSW 7 118566326 missense probably benign 0.00
R5939:Tmc7 UTSW 7 118545727 missense probably benign 0.33
R6251:Tmc7 UTSW 7 118561038 missense possibly damaging 0.83
R6642:Tmc7 UTSW 7 118545611 nonsense probably null
R6814:Tmc7 UTSW 7 118547623 missense probably benign 0.07
R6872:Tmc7 UTSW 7 118547623 missense probably benign 0.07
R6967:Tmc7 UTSW 7 118547678 missense probably benign 0.00
R7165:Tmc7 UTSW 7 118555934 missense probably benign 0.00
R7492:Tmc7 UTSW 7 118541966 missense probably benign 0.00
R7543:Tmc7 UTSW 7 118545756 missense probably benign 0.01
R8048:Tmc7 UTSW 7 118566245 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGCAGCTCGAGAAGTTAAG -3'
(R):5'- CTTCAGTGAAGGAGACAGGC -3'

Sequencing Primer
(F):5'- AGCAGCTCGAGAAGTTAAGTGTTTTG -3'
(R):5'- ACTGGAAGTCACTGTGGTAATC -3'
Posted On2018-06-22