Mutagenetix > Incidental Mutation

Incidental Mutation 'R6644:Myo5a'

526004

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

MMRRC Submission

044765-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R6644 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75146967 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 386 (T386A)

Ref Sequence

ENSEMBL: ENSMUSP00000116028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]

AlphaFold

Q99104

PDB Structure

Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000123128
AA Change: T386A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: T386A

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123531

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136731
AA Change: T386A

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: T386A

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142181

Predicted Effect

possibly damaging
Transcript: ENSMUST00000155282
AA Change: T386A

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: T386A

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.3%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,922	I130S	probably damaging	Het
Abca7	C	T	10: 80,008,764	P1461L	probably damaging	Het
Abhd14a	T	C	9: 106,444,273	Y10C	probably damaging	Het
Adcy2	C	T	13: 68,668,552	V772M	possibly damaging	Het
Apob	A	G	12: 8,009,077	M2487V	probably damaging	Het
B4galnt1	T	C	10: 127,171,793		probably null	Het
Cabp7	C	T	11: 4,740,396	V76I	probably benign	Het
Cbr3	A	G	16: 93,690,511	Y194C	probably damaging	Het
Cdk18	G	A	1: 132,122,069	Q58*	probably null	Het
Cryba4	T	C	5: 112,246,762	D167G	probably damaging	Het
Dner	T	C	1: 84,395,707	N588S	probably damaging	Het
Dnm1l	T	C	16: 16,329,873	I343V	probably benign	Het
Fam168b	C	A	1: 34,836,741	G21V	probably damaging	Het
Fam71d	T	A	12: 78,715,286	D241E	probably damaging	Het
Fbxw17	G	A	13: 50,423,219	R49Q	probably damaging	Het
Gm10332	T	A	14: 54,820,159	F59I	probably damaging	Het
Gm6803	A	G	12: 88,018,690	F28L	probably benign	Het
Gm8765	A	G	13: 50,702,035	T570A	possibly damaging	Het
Gnai3	A	G	3: 108,123,536		probably null	Het
Helz	T	A	11: 107,632,261	M75K	possibly damaging	Het
Hnrnph3	C	T	10: 63,018,893		probably benign	Het
Ifi211	C	T	1: 173,905,552	C181Y	probably benign	Het
Immp1l	A	G	2: 105,937,045	K83R	probably damaging	Het
Itga6	G	A	2: 71,841,124	G740R	probably damaging	Het
Klhl1	T	C	14: 96,517,918	T134A	probably benign	Het
Klhl7	A	G	5: 24,149,246	D353G	probably damaging	Het
Map3k1	A	G	13: 111,752,449	S1325P	probably benign	Het
Map3k4	A	G	17: 12,232,410		probably null	Het
Meioc	G	A	11: 102,668,460		probably null	Het
Mfap5	T	C	6: 122,520,596	F26L	probably damaging	Het
Npc1l1	A	T	11: 6,214,013	L1266Q	probably damaging	Het
Npc1l1	G	T	11: 6,214,014	L1266M	probably damaging	Het
Olfr1221	A	G	2: 89,111,981	M177T	probably benign	Het
Olfr612	C	A	7: 103,539,058	V59F	possibly damaging	Het
Pbld1	T	A	10: 63,075,063	S233T	probably damaging	Het
Phf12	A	G	11: 78,026,092	*789W	probably null	Het
Sf3b2	A	T	19: 5,279,964		probably null	Het
Slc23a3	A	G	1: 75,128,547	I459T	probably damaging	Het
Sptbn2	C	G	19: 4,749,012	R2037G	probably benign	Het
Stard9	A	C	2: 120,695,772	M837L	probably benign	Het
Stx5a	A	T	19: 8,755,248		probably benign	Het
Tmc7	A	G	7: 118,538,162	V719A	probably benign	Het
Trank1	T	A	9: 111,364,834	I642K	possibly damaging	Het
Trim34a	T	C	7: 104,261,037	Y349H	probably damaging	Het
Uba7	A	G	9: 107,981,472	Y834C	possibly damaging	Het
Ube2d1	A	G	10: 71,256,700	S105P	possibly damaging	Het
Vps13a	A	G	19: 16,744,919	V343A	possibly damaging	Het
Zbtb37	G	A	1: 161,032,073	Q221*	probably null	Het
Zfp119b	T	C	17: 55,939,148	N346S	probably benign	Het
Zfp708	G	T	13: 67,070,721	T358K	possibly damaging	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211126	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	splice site	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	splice site	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7497:Myo5a	UTSW	9	75197701	missense
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7939:Myo5a	UTSW	9	75189900	missense
R8050:Myo5a	UTSW	9	75181946	missense	probably damaging	0.99
R8061:Myo5a	UTSW	9	75122957	nonsense	probably null
R8326:Myo5a	UTSW	9	75217989	missense	probably damaging	0.98
R8529:Myo5a	UTSW	9	75212872	missense	probably benign	0.02
R8824:Myo5a	UTSW	9	75167046	missense	probably damaging	1.00
R8858:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9040:Myo5a	UTSW	9	75174059	missense	probably benign	0.07
R9092:Myo5a	UTSW	9	75147132	critical splice donor site	probably null
R9249:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9274:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9293:Myo5a	UTSW	9	75180030	missense	probably benign	0.37
R9366:Myo5a	UTSW	9	75217518	missense	probably damaging	0.98
R9410:Myo5a	UTSW	9	75116214	missense	probably damaging	0.98
R9644:Myo5a	UTSW	9	75136349	missense	probably damaging	1.00
R9649:Myo5a	UTSW	9	75192444	missense
R9748:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9766:Myo5a	UTSW	9	75171632	missense	probably damaging	0.99
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00
Z1177:Myo5a	UTSW	9	75186036	missense

Predicted Primers

PCR Primer
(F):5'- GCTTCTGATTATACTCACTGATCAGG -3'
(R):5'- TGCACTCACCCATAGATGTCC -3'

Sequencing Primer
(F):5'- GTCCATTTGACAAAGATAGTGCTG -3'
(R):5'- ATAGATGTCCAGCACGCCGATG -3'

Posted On

2018-06-22