Incidental Mutation 'R6644:Abhd14a'
ID526006
Institutional Source Beutler Lab
Gene Symbol Abhd14a
Ensembl Gene ENSMUSG00000042210
Gene Nameabhydrolase domain containing 14A
Synonyms1110013B16Rik, Dorz1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location106440051-106447678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106444273 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 10 (Y10C)
Ref Sequence ENSEMBL: ENSMUSP00000140901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048527] [ENSMUST00000048685] [ENSMUST00000171678] [ENSMUST00000171925] [ENSMUST00000185334] [ENSMUST00000185347] [ENSMUST00000185527] [ENSMUST00000186361] [ENSMUST00000187001] [ENSMUST00000187106] [ENSMUST00000187983] [ENSMUST00000190798] [ENSMUST00000215475] [ENSMUST00000217496] [ENSMUST00000216130] [ENSMUST00000190167]
Predicted Effect probably benign
Transcript: ENSMUST00000048527
SMART Domains Protein: ENSMUSP00000038755
Gene: ENSMUSG00000042073

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 189 7.9e-18 PFAM
Pfam:Abhydrolase_6 35 141 2.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048685
AA Change: Y10C

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047322
Gene: ENSMUSG00000042210
AA Change: Y10C

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171678
AA Change: Y10C

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126101
Gene: ENSMUSG00000042210
AA Change: Y10C

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171925
AA Change: Y10C

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126916
Gene: ENSMUSG00000042210
AA Change: Y10C

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Abhydrolase_5 73 245 7.9e-17 PFAM
low complexity region 253 265 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185334
AA Change: Y10C

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140345
Gene: ENSMUSG00000042210
AA Change: Y10C

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185347
SMART Domains Protein: ENSMUSP00000140279
Gene: ENSMUSG00000042073

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 183 7.6e-15 PFAM
Pfam:Abhydrolase_6 35 145 4.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185527
SMART Domains Protein: ENSMUSP00000139760
Gene: ENSMUSG00000042073

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 174 3.3e-14 PFAM
Pfam:Abhydrolase_6 35 144 3.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186361
SMART Domains Protein: ENSMUSP00000141151
Gene: ENSMUSG00000042073

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 189 1.5e-17 PFAM
Pfam:Abhydrolase_6 35 145 5.1e-15 PFAM
Pfam:Abhydrolase_6 141 194 1.5e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187001
AA Change: Y10C

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140042
Gene: ENSMUSG00000042210
AA Change: Y10C

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1imja_ 51 110 1e-10 SMART
PDB:1IMJ|A 58 110 6e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000187106
SMART Domains Protein: ENSMUSP00000139597
Gene: ENSMUSG00000042073

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 142 2.5e-9 PFAM
Pfam:Abhydrolase_6 35 141 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187798
Predicted Effect probably damaging
Transcript: ENSMUST00000187983
AA Change: Y10C

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140901
Gene: ENSMUSG00000042210
AA Change: Y10C

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Abhydrolase_5 73 203 5.4e-12 PFAM
Pfam:Abhydrolase_6 74 197 1.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190798
AA Change: Y10C

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141096
Gene: ENSMUSG00000042210
AA Change: Y10C

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 1.7e-8 PFAM
Pfam:Abhydrolase_5 73 157 1.2e-8 PFAM
Pfam:Abhydrolase_6 74 157 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215475
Predicted Effect probably benign
Transcript: ENSMUST00000217496
Predicted Effect probably benign
Transcript: ENSMUST00000216130
Predicted Effect probably benign
Transcript: ENSMUST00000190167
SMART Domains Protein: ENSMUSP00000140655
Gene: ENSMUSG00000042073

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 149 1.4e-9 PFAM
Pfam:Abhydrolase_6 35 147 1.6e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Abhd14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03051:Abhd14a APN 9 106443929 missense possibly damaging 0.49
IGL03204:Abhd14a APN 9 106440635 missense probably damaging 0.99
R0050:Abhd14a UTSW 9 106440883 unclassified probably benign
R1937:Abhd14a UTSW 9 106440247 unclassified probably benign
R2129:Abhd14a UTSW 9 106440865 missense probably null
R5521:Abhd14a UTSW 9 106443834 missense probably damaging 1.00
R5850:Abhd14a UTSW 9 106440349 missense probably damaging 1.00
R5971:Abhd14a UTSW 9 106443866 missense possibly damaging 0.93
R5975:Abhd14a UTSW 9 106443951 splice site probably null
R6138:Abhd14a UTSW 9 106443866 missense possibly damaging 0.93
R8171:Abhd14a UTSW 9 106440761 missense probably benign 0.10
U15987:Abhd14a UTSW 9 106443866 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GAGTAAACCTTCACCTGCGTG -3'
(R):5'- AGCTAACACAGTGATAATGATAGCC -3'

Sequencing Primer
(F):5'- CGTGCCTGCTGGATTGGC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2018-06-22