Incidental Mutation 'R6596:Dcstamp'
ID526009
Institutional Source Beutler Lab
Gene Symbol Dcstamp
Ensembl Gene ENSMUSG00000022303
Gene Namedendrocyte expressed seven transmembrane protein
SynonymsTm7sf4, 4833414I07Rik, DC-STAMP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.522) question?
Stock #R6596 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location39745930-39760938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 39754209 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 5 (T5P)
Ref Sequence ENSEMBL: ENSMUSP00000153957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022913] [ENSMUST00000227368] [ENSMUST00000227792] [ENSMUST00000228556] [ENSMUST00000228701]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022913
AA Change: T5P

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022913
Gene: ENSMUSG00000022303
AA Change: T5P

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
transmembrane domain 58 75 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Pfam:DC_STAMP 242 421 1e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227368
AA Change: T5P

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227792
AA Change: T5P

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228556
AA Change: T5P

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect unknown
Transcript: ENSMUST00000228701
AA Change: T5P
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-pass transmembrane protein that is primarily expressed in dendritic cells. The encoded protein is involved in a range of immunological functions carried out by dendritic cells. This protein plays a role in osteoclastogenesis and myeloid differentiation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Targeted disruption of this gene causes complete loss of osteoclast and macrophage cell fusion and leads to reduced bone-resorbing activity and mild osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,942,785 C135S possibly damaging Het
Bag4 C T 8: 25,769,500 D224N probably damaging Het
Cldn15 T A 5: 136,974,679 C178* probably null Het
Col7a1 C A 9: 108,954,341 probably benign Het
Crnn G A 3: 93,146,875 E22K probably damaging Het
Dennd4a A G 9: 64,852,420 Y269C probably damaging Het
Dsg1c T A 18: 20,270,524 probably null Het
Duox2 C T 2: 122,285,338 V972I probably benign Het
Ephb1 A C 9: 102,194,802 Y259* probably null Het
Fam149a G T 8: 45,381,630 T44K probably benign Het
Fn1 A G 1: 71,609,482 Y1423H probably damaging Het
Garem1 T A 18: 21,148,739 I187F probably damaging Het
Gfm2 C T 13: 97,165,149 P487S probably damaging Het
Gm5039 C A 12: 88,321,287 L65F possibly damaging Het
Hyou1 A G 9: 44,387,755 E625G probably benign Het
Kmt5a G A 5: 124,450,696 V121M probably benign Het
Mindy4 T C 6: 55,224,016 S229P probably damaging Het
Muc16 T C 9: 18,566,715 D7098G probably benign Het
Nsf A T 11: 103,910,457 I244N probably damaging Het
Obox1 C T 7: 15,555,376 S72L probably damaging Het
Olfr1166 C T 2: 88,124,199 C262Y probably damaging Het
Olfr1270 T A 2: 90,149,278 T243S possibly damaging Het
Pcdhb7 A T 18: 37,343,361 I517F probably damaging Het
Plk2 C T 13: 110,397,762 A292V probably benign Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Rasgrf1 A T 9: 90,012,794 N1089I possibly damaging Het
Robo2 T A 16: 73,971,108 N603Y probably damaging Het
Slc35f4 G A 14: 49,525,600 A5V probably damaging Het
Smc4 A T 3: 69,025,893 I616F probably damaging Het
Sorl1 T G 9: 42,001,603 N1361H possibly damaging Het
Syngr1 C T 15: 80,111,692 T144M probably damaging Het
Tbc1d16 A C 11: 119,157,775 W351G probably damaging Het
Tbx15 A G 3: 99,352,192 S460G probably benign Het
Tns2 G A 15: 102,110,559 R395Q probably benign Het
Tpte T C 8: 22,333,269 L304P probably damaging Het
Tubgcp5 T A 7: 55,806,634 F325I probably benign Het
Ucp3 A T 7: 100,481,933 I198F probably benign Het
Vit T C 17: 78,622,845 V413A probably benign Het
Xrcc6 T C 15: 82,022,954 M1T probably null Het
Other mutations in Dcstamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Dcstamp APN 15 39754416 missense probably benign 0.05
IGL01963:Dcstamp APN 15 39760359 missense possibly damaging 0.82
IGL02132:Dcstamp APN 15 39754532 missense probably damaging 0.97
IGL02139:Dcstamp APN 15 39754458 missense probably damaging 1.00
IGL02607:Dcstamp APN 15 39754584 missense possibly damaging 0.94
IGL03003:Dcstamp APN 15 39754510 missense possibly damaging 0.64
IGL03061:Dcstamp APN 15 39760397 missense possibly damaging 0.81
IGL03191:Dcstamp APN 15 39754224 missense probably benign 0.00
R1144:Dcstamp UTSW 15 39760368 missense possibly damaging 0.94
R1186:Dcstamp UTSW 15 39754629 unclassified probably null
R1663:Dcstamp UTSW 15 39754944 nonsense probably null
R2117:Dcstamp UTSW 15 39755175 nonsense probably null
R2202:Dcstamp UTSW 15 39754312 missense probably damaging 0.99
R4484:Dcstamp UTSW 15 39754224 missense probably benign 0.00
R4642:Dcstamp UTSW 15 39754722 missense probably benign 0.01
R5384:Dcstamp UTSW 15 39759319 missense probably damaging 0.99
R5529:Dcstamp UTSW 15 39754536 missense probably benign 0.04
R5558:Dcstamp UTSW 15 39759540 missense probably damaging 1.00
R5562:Dcstamp UTSW 15 39754402 missense possibly damaging 0.88
R6261:Dcstamp UTSW 15 39754735 missense possibly damaging 0.65
R6299:Dcstamp UTSW 15 39755203 missense probably damaging 1.00
R6377:Dcstamp UTSW 15 39754921 missense probably benign 0.01
R6566:Dcstamp UTSW 15 39754336 missense possibly damaging 0.54
R6869:Dcstamp UTSW 15 39754458 missense probably damaging 1.00
R7030:Dcstamp UTSW 15 39759533 missense probably damaging 0.96
R7945:Dcstamp UTSW 15 39760401 makesense probably null
R8178:Dcstamp UTSW 15 39755026 missense probably damaging 1.00
Z1177:Dcstamp UTSW 15 39759596 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCATTTCTTGGTGGGAGTCC -3'
(R):5'- GAAAACACAGGTGATCATCCAG -3'

Sequencing Primer
(F):5'- GTCCTGGAACTCACCTTGTAGAC -3'
(R):5'- CACAGGTGATCATCCAGACAGAAG -3'
Posted On2018-06-22