Incidental Mutation 'R6644:Hnrnph3'
ID526012
Institutional Source Beutler Lab
Gene Symbol Hnrnph3
Ensembl Gene ENSMUSG00000020069
Gene Nameheterogeneous nuclear ribonucleoprotein H3
SynonymshnRNP 2H9, Hnrph3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location63014664-63024217 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 63018893 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020263] [ENSMUST00000118898] [ENSMUST00000119567] [ENSMUST00000119814] [ENSMUST00000140743] [ENSMUST00000143594]
Predicted Effect unknown
Transcript: ENSMUST00000020263
AA Change: E40K
SMART Domains Protein: ENSMUSP00000020263
Gene: ENSMUSG00000020069
AA Change: E40K

DomainStartEndE-ValueType
RRM 17 89 1.11e-7 SMART
low complexity region 102 191 N/A INTRINSIC
RRM 196 266 7.96e-9 SMART
low complexity region 272 286 N/A INTRINSIC
low complexity region 294 341 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118898
AA Change: E40K
SMART Domains Protein: ENSMUSP00000112424
Gene: ENSMUSG00000020069
AA Change: E40K

DomainStartEndE-ValueType
RRM 17 89 1.11e-7 SMART
low complexity region 102 176 N/A INTRINSIC
RRM 181 251 7.96e-9 SMART
low complexity region 257 271 N/A INTRINSIC
low complexity region 279 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119567
SMART Domains Protein: ENSMUSP00000113429
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 515 N/A INTRINSIC
FYVE 532 599 6.99e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119814
SMART Domains Protein: ENSMUSP00000113134
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
PDB:1WG5|A 10 39 3e-11 PDB
Blast:RRM 17 43 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140743
SMART Domains Protein: ENSMUSP00000118444
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
PDB:1WG5|A 10 39 3e-11 PDB
Blast:RRM 17 43 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141616
Predicted Effect probably benign
Transcript: ENSMUST00000143594
SMART Domains Protein: ENSMUSP00000115339
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 406 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143689
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It is localized in nuclear bodies of the nucleus. This protein is involved in the splicing process and it also participates in early heat shock-induced splicing arrest by transiently leaving the hnRNP complexes. Several alternatively spliced transcript variants have been noted for this gene, however, not all are fully characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Hnrnph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Hnrnph3 APN 10 63018124 makesense probably null
IGL02112:Hnrnph3 APN 10 63016405 critical splice donor site probably null
IGL02116:Hnrnph3 APN 10 63016076 intron probably benign
IGL02193:Hnrnph3 APN 10 63017277 missense probably damaging 0.98
IGL02211:Hnrnph3 APN 10 63017342 unclassified probably benign
IGL02410:Hnrnph3 APN 10 63015724 intron probably benign
IGL02616:Hnrnph3 APN 10 63019485 missense possibly damaging 0.66
IGL03033:Hnrnph3 APN 10 63018179 missense probably benign 0.00
IGL03367:Hnrnph3 APN 10 63017229 missense probably damaging 1.00
R0450:Hnrnph3 UTSW 10 63018215 missense probably benign 0.01
R0450:Hnrnph3 UTSW 10 63019500 missense probably damaging 0.99
R0469:Hnrnph3 UTSW 10 63018215 missense probably benign 0.01
R0469:Hnrnph3 UTSW 10 63019500 missense probably damaging 0.99
R1585:Hnrnph3 UTSW 10 63015800 critical splice donor site probably null
R4285:Hnrnph3 UTSW 10 63016468 missense probably damaging 1.00
R4706:Hnrnph3 UTSW 10 63017280 missense probably damaging 1.00
R5606:Hnrnph3 UTSW 10 63019443 missense possibly damaging 0.94
R5873:Hnrnph3 UTSW 10 63019391 critical splice donor site probably null
R5952:Hnrnph3 UTSW 10 63015595 intron probably benign
R6059:Hnrnph3 UTSW 10 63018862 unclassified probably benign
R7517:Hnrnph3 UTSW 10 63018895 missense unknown
Predicted Primers PCR Primer
(F):5'- AAATGTTATGCTTACCCACCCC -3'
(R):5'- GTGAGTTACCATTGGGAGCAC -3'

Sequencing Primer
(F):5'- ATGCTTACCCACCCCATTTAAG -3'
(R):5'- GTTACCATTGGGAGCACAGTTAATG -3'
Posted On2018-06-22