Incidental Mutation 'R6644:B4galnt1'
ID526020
Institutional Source Beutler Lab
Gene Symbol B4galnt1
Ensembl Gene ENSMUSG00000006731
Gene Namebeta-1,4-N-acetyl-galactosaminyl transferase 1
SynonymsGgm2, Gal-NAc-T, GalNAcT, beta1,4GalNAC-T, GalNAc-T, Ggm-2, GM2/GD2 synthase, 4933429D13Rik, Galgt1
MMRRC Submission
Accession Numbers

Genbank: NM_008080; MGI: 1342057  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127165225-127172330 bp(+) (GRCm38)
Type of Mutationsplice site (633 bp from exon)
DNA Base Change (assembly) T to C at 127171793 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006914] [ENSMUST00000095270] [ENSMUST00000217678] [ENSMUST00000222911]
Predicted Effect probably damaging
Transcript: ENSMUST00000006914
AA Change: L521P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006914
Gene: ENSMUSG00000006731
AA Change: L521P

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
Pfam:Glycos_transf_2 280 450 7e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095270
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221174
Predicted Effect probably benign
Transcript: ENSMUST00000222911
Meta Mutation Damage Score 0.2347 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GM2 and GD2 gangliosides are sialic acid-containing glycosphingolipids. GalNAc-T is the enzyme involved in the biosynthesis of G(M2) and G(D2) glycosphingolipids. GalNAc-T catalyzes the transfer of GalNAc into G(M3) and G(D3) by a beta-1,4 linkage, resulting in the synthesis of G(M2) and G(D2), respectively. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for one knock-out allele lack all complex gangliosides but show normal brain histology and gross behavior with only subtle defects in neural conduction velocities. Mice homozygous for another knock-out allele exhibit male infertility due to degeneration of the seminiferous tubules. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in B4galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:B4galnt1 APN 10 127167764 missense probably benign 0.01
IGL01087:B4galnt1 APN 10 127166191 missense probably damaging 1.00
IGL01301:B4galnt1 APN 10 127169779 missense possibly damaging 0.56
IGL01924:B4galnt1 APN 10 127166761 missense probably benign 0.01
IGL02996:B4galnt1 APN 10 127167003 missense probably damaging 1.00
Hypokalemic UTSW 10 127171793 splice site probably null
ANU18:B4galnt1 UTSW 10 127169779 missense possibly damaging 0.56
R0233:B4galnt1 UTSW 10 127170911 unclassified probably benign
R4646:B4galnt1 UTSW 10 127167836 missense probably damaging 0.99
R4702:B4galnt1 UTSW 10 127167525 missense possibly damaging 0.90
R4703:B4galnt1 UTSW 10 127167525 missense possibly damaging 0.90
R4705:B4galnt1 UTSW 10 127167525 missense possibly damaging 0.90
R4708:B4galnt1 UTSW 10 127169815 missense probably damaging 1.00
R5377:B4galnt1 UTSW 10 127171822 missense possibly damaging 0.95
R7006:B4galnt1 UTSW 10 127169831 missense probably benign 0.00
R7278:B4galnt1 UTSW 10 127167788 missense probably benign 0.01
R7396:B4galnt1 UTSW 10 127171616 missense possibly damaging 0.89
R7886:B4galnt1 UTSW 10 127167054 missense probably damaging 0.99
R7935:B4galnt1 UTSW 10 127171621 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAATTCTTCCTGGATGGAC -3'
(R):5'- TCTGGTCGCTCACAGAAAGG -3'

Sequencing Primer
(F):5'- CCTGGATGGACTTGGTTTCC -3'
(R):5'- CAAGCCCCTGTTAGGAATCAGATTG -3'
Posted On2018-06-22