Incidental Mutation 'R6644:Npc1l1'
ID526024
Institutional Source Beutler Lab
Gene Symbol Npc1l1
Ensembl Gene ENSMUSG00000020447
Gene NameNPC1 like intracellular cholesterol transporter 1
Synonyms9130221N23Rik, Niemann-Pick disease, type C1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6644 (G1)
Quality Score138.008
Status Validated
Chromosome11
Chromosomal Location6211013-6230143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6214013 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1266 (L1266Q)
Ref Sequence ENSEMBL: ENSMUSP00000004505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004505]
Predicted Effect probably damaging
Transcript: ENSMUST00000004505
AA Change: L1266Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447
AA Change: L1266Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NPC1_N 28 283 8.7e-74 PFAM
low complexity region 294 307 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:Patched 385 897 4.7e-52 PFAM
Pfam:Sterol-sensing 661 815 5.7e-55 PFAM
Pfam:MMPL 665 830 2.3e-11 PFAM
Pfam:Patched 1063 1268 6.2e-34 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Npc1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Npc1l1 APN 11 6224199 missense probably damaging 1.00
IGL01348:Npc1l1 APN 11 6227974 missense probably damaging 1.00
IGL01891:Npc1l1 APN 11 6214280 missense probably damaging 1.00
IGL01897:Npc1l1 APN 11 6227879 missense probably benign
IGL02098:Npc1l1 APN 11 6214581 missense probably damaging 0.99
IGL02121:Npc1l1 APN 11 6228157 missense probably benign
IGL02724:Npc1l1 APN 11 6214684 missense possibly damaging 0.88
IGL02947:Npc1l1 APN 11 6229246 missense probably benign 0.01
IGL03328:Npc1l1 APN 11 6218643 nonsense probably null
R0137:Npc1l1 UTSW 11 6228148 nonsense probably null
R0322:Npc1l1 UTSW 11 6229042 missense probably benign
R0352:Npc1l1 UTSW 11 6223076 missense probably benign 0.00
R0492:Npc1l1 UTSW 11 6223040 missense possibly damaging 0.82
R0918:Npc1l1 UTSW 11 6218239 missense probably damaging 1.00
R1300:Npc1l1 UTSW 11 6227859 missense probably damaging 1.00
R1455:Npc1l1 UTSW 11 6228174 missense possibly damaging 0.66
R1588:Npc1l1 UTSW 11 6217785 missense probably benign 0.01
R1803:Npc1l1 UTSW 11 6228846 missense probably damaging 1.00
R1882:Npc1l1 UTSW 11 6217473 splice site probably null
R1944:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6225199 nonsense probably null
R3155:Npc1l1 UTSW 11 6221840 missense probably benign
R4343:Npc1l1 UTSW 11 6217773 missense probably benign
R4504:Npc1l1 UTSW 11 6228741 missense possibly damaging 0.61
R4610:Npc1l1 UTSW 11 6228215 missense probably damaging 1.00
R4807:Npc1l1 UTSW 11 6218723 missense probably damaging 1.00
R4829:Npc1l1 UTSW 11 6214010 critical splice donor site probably null
R5135:Npc1l1 UTSW 11 6224245 missense possibly damaging 0.94
R5290:Npc1l1 UTSW 11 6222221 missense probably benign 0.00
R5369:Npc1l1 UTSW 11 6217705 critical splice donor site probably null
R5388:Npc1l1 UTSW 11 6214733 missense probably damaging 1.00
R5532:Npc1l1 UTSW 11 6224245 missense probably damaging 0.98
R5540:Npc1l1 UTSW 11 6214546 missense probably damaging 1.00
R5754:Npc1l1 UTSW 11 6227839 missense probably damaging 1.00
R5760:Npc1l1 UTSW 11 6229031 missense probably benign 0.02
R6057:Npc1l1 UTSW 11 6217806 missense possibly damaging 0.66
R6388:Npc1l1 UTSW 11 6224145 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214014 missense probably damaging 0.98
R6756:Npc1l1 UTSW 11 6215153 missense probably damaging 1.00
R6790:Npc1l1 UTSW 11 6214260 splice site probably null
R7006:Npc1l1 UTSW 11 6217731 missense probably benign
R7062:Npc1l1 UTSW 11 6217807 missense probably benign
R7273:Npc1l1 UTSW 11 6218320 missense probably damaging 1.00
R7383:Npc1l1 UTSW 11 6217777 missense probably benign 0.30
X0022:Npc1l1 UTSW 11 6228058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCCACACAGTGTTTAAGAC -3'
(R):5'- GATCCACCTGAGCCTTTATGTC -3'

Sequencing Primer
(F):5'- TGTTTAAGACACAATCAACTCACAG -3'
(R):5'- TGCTGACTCCTGGCTGTGAC -3'
Posted On2018-06-22