Incidental Mutation 'R6644:Phf12'
ID 526026
Institutional Source Beutler Lab
Gene Symbol Phf12
Ensembl Gene ENSMUSG00000037791
Gene Name PHD finger protein 12
Synonyms 2410142K10Rik, PF1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.726) question?
Stock # R6644 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 77982754-78030539 bp(+) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) A to G at 78026092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 789 (*789W)
Ref Sequence ENSEMBL: ENSMUSP00000103997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049167] [ENSMUST00000108360] [ENSMUST00000131680] [ENSMUST00000153428]
AlphaFold Q5SPL2
Predicted Effect probably benign
Transcript: ENSMUST00000049167
SMART Domains Protein: ENSMUSP00000044990
Gene: ENSMUSG00000037791

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
PHD 58 103 7.23e-11 SMART
low complexity region 182 200 N/A INTRINSIC
Pfam:PHF12_MRG_bd 202 241 1.3e-21 PFAM
PHD 273 319 1.66e-10 SMART
low complexity region 616 630 N/A INTRINSIC
Blast:FHA 813 868 9e-34 BLAST
low complexity region 905 916 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108360
AA Change: *789W
SMART Domains Protein: ENSMUSP00000103997
Gene: ENSMUSG00000037791
AA Change: *789W

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
PHD 58 103 7.23e-11 SMART
low complexity region 182 200 N/A INTRINSIC
PDB:2L9S|A 201 241 2e-20 PDB
PHD 273 319 1.66e-10 SMART
low complexity region 616 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125079
Predicted Effect probably benign
Transcript: ENSMUST00000131680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150471
Predicted Effect unknown
Transcript: ENSMUST00000153428
AA Change: D258G
SMART Domains Protein: ENSMUSP00000119390
Gene: ENSMUSG00000037791
AA Change: D258G

DomainStartEndE-ValueType
low complexity region 67 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153747
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Phf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Phf12 APN 11 78015506 missense probably damaging 0.98
IGL00919:Phf12 APN 11 77983340 missense probably damaging 1.00
IGL01434:Phf12 APN 11 78023559 missense probably damaging 1.00
IGL02219:Phf12 APN 11 77984196 missense probably damaging 0.97
IGL02727:Phf12 APN 11 78023667 missense possibly damaging 0.83
IGL03064:Phf12 APN 11 77983360 missense probably damaging 1.00
IGL03117:Phf12 APN 11 78023020 unclassified probably benign
Fossa UTSW 11 78006782 missense probably damaging 0.99
lemur UTSW 11 78024954 splice site probably benign
R0457:Phf12 UTSW 11 78018168 missense possibly damaging 0.94
R0477:Phf12 UTSW 11 78023070 missense possibly damaging 0.94
R0656:Phf12 UTSW 11 78029332 missense probably benign 0.44
R0905:Phf12 UTSW 11 78009404 nonsense probably null
R1719:Phf12 UTSW 11 78023601 missense probably damaging 1.00
R1742:Phf12 UTSW 11 78009486 missense probably benign 0.04
R1826:Phf12 UTSW 11 78024954 splice site probably benign
R2270:Phf12 UTSW 11 77984175 missense possibly damaging 0.82
R2875:Phf12 UTSW 11 78009747 missense probably damaging 1.00
R2885:Phf12 UTSW 11 78023769 missense possibly damaging 0.75
R5020:Phf12 UTSW 11 78023796 missense probably damaging 1.00
R5570:Phf12 UTSW 11 78018111 missense possibly damaging 0.89
R5573:Phf12 UTSW 11 78025045 missense probably damaging 1.00
R5689:Phf12 UTSW 11 78023725 missense probably damaging 1.00
R5727:Phf12 UTSW 11 78023544 missense probably damaging 1.00
R5807:Phf12 UTSW 11 78022426 missense probably benign 0.16
R5910:Phf12 UTSW 11 78027398 missense probably damaging 1.00
R6034:Phf12 UTSW 11 78018069 missense probably benign 0.08
R6034:Phf12 UTSW 11 78018069 missense probably benign 0.08
R6049:Phf12 UTSW 11 78028170 splice site probably null
R6052:Phf12 UTSW 11 78018218 missense probably benign 0.31
R6056:Phf12 UTSW 11 78009515 missense probably benign 0.09
R6208:Phf12 UTSW 11 78023591 missense probably damaging 0.97
R6805:Phf12 UTSW 11 78027373 missense probably damaging 1.00
R6823:Phf12 UTSW 11 78022511 nonsense probably null
R7047:Phf12 UTSW 11 78013273 missense probably damaging 0.99
R7159:Phf12 UTSW 11 78023540 missense possibly damaging 0.76
R7602:Phf12 UTSW 11 78023283 missense probably benign
R7618:Phf12 UTSW 11 78026134 missense unknown
R8162:Phf12 UTSW 11 78024825 missense probably damaging 0.99
R8290:Phf12 UTSW 11 78029639 missense probably benign 0.02
R8544:Phf12 UTSW 11 78027409 missense probably damaging 0.99
R8834:Phf12 UTSW 11 78006782 missense probably damaging 0.99
R9018:Phf12 UTSW 11 78023684 missense possibly damaging 0.51
X0013:Phf12 UTSW 11 78009791 missense probably damaging 1.00
X0027:Phf12 UTSW 11 78028895 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCTGGCCTTGCAGAGAGTAC -3'
(R):5'- TCTCACCTTGAACCTTAGGAAAAC -3'

Sequencing Primer
(F):5'- GCAGAGAGTACATCAGCTTTTCC -3'
(R):5'- CACGGTGCTTTATTAAACCC -3'
Posted On 2018-06-22