Incidental Mutation 'R6644:Dnm1l'
ID526039
Institutional Source Beutler Lab
Gene Symbol Dnm1l
Ensembl Gene ENSMUSG00000022789
Gene Namedynamin 1-like
Synonyms6330417M19Rik, python, Dnmlp1, Drp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location16312230-16358959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16329873 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 343 (I343V)
Ref Sequence ENSEMBL: ENSMUSP00000155155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023477] [ENSMUST00000096229] [ENSMUST00000115749] [ENSMUST00000230022] [ENSMUST00000230980]
Predicted Effect probably benign
Transcript: ENSMUST00000023477
AA Change: I337V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023477
Gene: ENSMUSG00000022789
AA Change: I337V

DomainStartEndE-ValueType
DYNc 1 255 9.83e-124 SMART
low complexity region 556 571 N/A INTRINSIC
GED 602 693 2.52e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096229
AA Change: I350V

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093945
Gene: ENSMUSG00000022789
AA Change: I350V

DomainStartEndE-ValueType
DYNc 1 268 1.75e-120 SMART
low complexity region 569 584 N/A INTRINSIC
GED 615 706 2.52e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115749
AA Change: I188V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000111415
Gene: ENSMUSG00000022789
AA Change: I188V

DomainStartEndE-ValueType
DYNc 1 261 2.08e-122 SMART
low complexity region 573 588 N/A INTRINSIC
GED 619 710 2.52e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230022
AA Change: I239V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000230980
AA Change: I343V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin family. The encoded protein is localized to the cytoplasm and mitochondrial membrane, is involved in mitochondrial and peroxisomal division, and is essential for mitochondrial fission. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality at E11.5 with internal hemorrhage and small size. Mice heterozygous for an ENU induced allele have dilated cardiomyopathy and congestive heart failure, homozygous are embryonic lethal with posterior truncation at E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Dnm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Dnm1l APN 16 16333827 critical splice donor site probably null
IGL00696:Dnm1l APN 16 16342715 missense probably benign
IGL01146:Dnm1l APN 16 16314325 missense probably benign 0.01
IGL01385:Dnm1l APN 16 16341453 missense probably damaging 1.00
IGL01694:Dnm1l APN 16 16316651 missense probably benign 0.08
IGL02250:Dnm1l APN 16 16321686 splice site probably benign
IGL02335:Dnm1l APN 16 16342740 intron probably benign
IGL02345:Dnm1l APN 16 16329894 missense possibly damaging 0.61
IGL02403:Dnm1l APN 16 16336976 missense possibly damaging 0.78
IGL02684:Dnm1l APN 16 16321657 missense possibly damaging 0.95
IGL02869:Dnm1l APN 16 16341424 nonsense probably null
IGL03388:Dnm1l APN 16 16314052 splice site probably benign
R0068:Dnm1l UTSW 16 16324019 missense probably damaging 1.00
R0068:Dnm1l UTSW 16 16324019 missense probably damaging 1.00
R1259:Dnm1l UTSW 16 16324006 missense possibly damaging 0.67
R1554:Dnm1l UTSW 16 16341426 missense probably benign 0.13
R1756:Dnm1l UTSW 16 16342695 critical splice donor site probably null
R1913:Dnm1l UTSW 16 16329966 missense probably benign 0.45
R2906:Dnm1l UTSW 16 16314311 missense probably damaging 0.96
R2907:Dnm1l UTSW 16 16314311 missense probably damaging 0.96
R3756:Dnm1l UTSW 16 16321612 missense possibly damaging 0.86
R4226:Dnm1l UTSW 16 16314387 missense possibly damaging 0.80
R4414:Dnm1l UTSW 16 16342695 critical splice donor site probably null
R5287:Dnm1l UTSW 16 16333868 missense probably damaging 1.00
R5574:Dnm1l UTSW 16 16329821 missense probably damaging 1.00
R5653:Dnm1l UTSW 16 16319489 missense probably damaging 1.00
R6113:Dnm1l UTSW 16 16341003 missense probably benign 0.00
R6320:Dnm1l UTSW 16 16332088 missense probably damaging 1.00
R6995:Dnm1l UTSW 16 16329807 nonsense probably null
R7309:Dnm1l UTSW 16 16321646 missense probably damaging 1.00
R7422:Dnm1l UTSW 16 16318474 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGACACAATACTCCTCCTATCATT -3'
(R):5'- CGGACATGTTGAAGATCTGAGTACT -3'

Sequencing Primer
(F):5'- GATTCTTATAATCCAAGCAACCA -3'
(R):5'- GATCTGAGTACTAGAAGATTTGCCC -3'
Posted On2018-06-22