Incidental Mutation 'R6644:Map3k4'
ID526041
Institutional Source Beutler Lab
Gene Symbol Map3k4
Ensembl Gene ENSMUSG00000014426
Gene Namemitogen-activated protein kinase kinase kinase 4
SynonymsD17Rp17, D17Rp17e, RP17, MAPKKK4, Mekk4, MTK1, Tas
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location12227621-12318660 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 12232410 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000086459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089058]
Predicted Effect probably null
Transcript: ENSMUST00000089058
SMART Domains Protein: ENSMUSP00000086459
Gene: ENSMUSG00000014426

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
low complexity region 215 235 N/A INTRINSIC
low complexity region 432 462 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
S_TKc 1332 1590 1.41e-91 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit some perinatal lethality and survivors appear smaller. On certain genetic backgrounds, heterozygous X/Y mice may develop as phenotypic females or hermaphrodites. The sex-reversal phenotype is dependent on a combination of strain-specific autosomal and Y-linked alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Map3k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Map3k4 APN 17 12232990 missense probably damaging 1.00
IGL01124:Map3k4 APN 17 12255200 missense probably benign 0.01
IGL01125:Map3k4 APN 17 12271962 missense probably damaging 0.96
IGL01585:Map3k4 APN 17 12248959 missense probably damaging 1.00
IGL02194:Map3k4 APN 17 12248995 missense probably benign 0.30
IGL02194:Map3k4 APN 17 12263928 missense probably damaging 1.00
IGL02292:Map3k4 APN 17 12235158 missense possibly damaging 0.77
IGL02326:Map3k4 APN 17 12249010 missense probably damaging 1.00
IGL02388:Map3k4 APN 17 12271610 missense probably damaging 0.99
IGL02621:Map3k4 APN 17 12264013 missense probably damaging 1.00
IGL02668:Map3k4 APN 17 12235953 missense possibly damaging 0.85
IGL02850:Map3k4 APN 17 12271914 missense probably damaging 1.00
IGL02939:Map3k4 APN 17 12272149 missense probably damaging 1.00
IGL03148:Map3k4 APN 17 12238158 missense probably benign 0.01
IGL03238:Map3k4 APN 17 12271158 missense probably benign 0.10
ANU74:Map3k4 UTSW 17 12232976 missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12238189 missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12238189 missense probably damaging 1.00
R0128:Map3k4 UTSW 17 12248063 missense probably damaging 0.99
R0183:Map3k4 UTSW 17 12235128 missense probably damaging 1.00
R0309:Map3k4 UTSW 17 12271015 frame shift probably null
R0355:Map3k4 UTSW 17 12254171 missense probably damaging 1.00
R0367:Map3k4 UTSW 17 12258041 splice site probably benign
R1103:Map3k4 UTSW 17 12237063 splice site probably null
R1446:Map3k4 UTSW 17 12256794 nonsense probably null
R1542:Map3k4 UTSW 17 12235906 missense probably damaging 0.97
R1713:Map3k4 UTSW 17 12249571 missense probably benign 0.39
R1777:Map3k4 UTSW 17 12271730 missense possibly damaging 0.82
R1797:Map3k4 UTSW 17 12264019 missense probably benign 0.30
R1997:Map3k4 UTSW 17 12254995 critical splice donor site probably null
R2042:Map3k4 UTSW 17 12277983 missense probably damaging 0.99
R2878:Map3k4 UTSW 17 12264067 missense probably benign 0.00
R2939:Map3k4 UTSW 17 12261270 missense probably damaging 0.98
R2940:Map3k4 UTSW 17 12261270 missense probably damaging 0.98
R3405:Map3k4 UTSW 17 12256781 missense probably damaging 1.00
R3930:Map3k4 UTSW 17 12235993 missense possibly damaging 0.83
R4291:Map3k4 UTSW 17 12255260 missense probably benign 0.08
R4410:Map3k4 UTSW 17 12248998 missense probably damaging 1.00
R4632:Map3k4 UTSW 17 12232504 missense probably damaging 1.00
R4641:Map3k4 UTSW 17 12264045 missense probably damaging 1.00
R4726:Map3k4 UTSW 17 12232964 missense possibly damaging 0.89
R4730:Map3k4 UTSW 17 12248974 missense probably damaging 0.99
R4832:Map3k4 UTSW 17 12271780 missense probably damaging 1.00
R4896:Map3k4 UTSW 17 12272019 missense possibly damaging 0.65
R4934:Map3k4 UTSW 17 12271900 missense probably damaging 1.00
R4971:Map3k4 UTSW 17 12249495 critical splice donor site probably null
R4980:Map3k4 UTSW 17 12272071 missense probably damaging 1.00
R5211:Map3k4 UTSW 17 12232434 missense possibly damaging 0.88
R5337:Map3k4 UTSW 17 12271610 missense probably damaging 0.99
R5356:Map3k4 UTSW 17 12247308 missense possibly damaging 0.87
R5550:Map3k4 UTSW 17 12243558 nonsense probably null
R5824:Map3k4 UTSW 17 12229639 missense probably damaging 1.00
R5890:Map3k4 UTSW 17 12271416 missense probably damaging 1.00
R6285:Map3k4 UTSW 17 12264058 missense probably damaging 1.00
R6380:Map3k4 UTSW 17 12272067 missense possibly damaging 0.56
R6383:Map3k4 UTSW 17 12249583 missense possibly damaging 0.82
R6571:Map3k4 UTSW 17 12242692 missense possibly damaging 0.80
R6584:Map3k4 UTSW 17 12260491 missense probably damaging 1.00
R6616:Map3k4 UTSW 17 12271344 missense probably damaging 1.00
R6909:Map3k4 UTSW 17 12270985 missense probably damaging 1.00
R6947:Map3k4 UTSW 17 12260569 nonsense probably null
R6970:Map3k4 UTSW 17 12248916 missense probably damaging 1.00
R7120:Map3k4 UTSW 17 12271467 missense probably damaging 1.00
R7253:Map3k4 UTSW 17 12272068 missense probably benign 0.00
R7267:Map3k4 UTSW 17 12271649 nonsense probably null
R7322:Map3k4 UTSW 17 12270946 missense probably damaging 1.00
R7522:Map3k4 UTSW 17 12261332 missense probably benign 0.39
R7554:Map3k4 UTSW 17 12232413 missense probably damaging 1.00
R7554:Map3k4 UTSW 17 12232414 nonsense probably null
R7681:Map3k4 UTSW 17 12318543 missense unknown
R7734:Map3k4 UTSW 17 12264111 missense probably damaging 1.00
R7842:Map3k4 UTSW 17 12271143 missense possibly damaging 0.54
R8013:Map3k4 UTSW 17 12271031 nonsense probably null
R8014:Map3k4 UTSW 17 12271031 nonsense probably null
R8235:Map3k4 UTSW 17 12240081 splice site probably null
R8294:Map3k4 UTSW 17 12318613 missense unknown
X0067:Map3k4 UTSW 17 12264094 missense probably benign 0.03
Z1177:Map3k4 UTSW 17 12271697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCCCTCTGGAGTTGTCC -3'
(R):5'- TGCTGAGGAGTAACAACATATTGC -3'

Sequencing Primer
(F):5'- AGTGCGGGATAAAGCTCTCC -3'
(R):5'- GGAGTAACAACATATTGCTTGGTGC -3'
Posted On2018-06-22