Incidental Mutation 'R6644:Zfp119b'
ID526042
Institutional Source Beutler Lab
Gene Symbol Zfp119b
Ensembl Gene ENSMUSG00000062101
Gene Namezinc finger protein 119b
SynonymsBC031441
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location55938381-55949500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55939148 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 346 (N346S)
Ref Sequence ENSEMBL: ENSMUSP00000058300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056147] [ENSMUST00000189452]
Predicted Effect probably benign
Transcript: ENSMUST00000056147
AA Change: N346S

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058300
Gene: ENSMUSG00000062101
AA Change: N346S

DomainStartEndE-ValueType
KRAB 4 56 2e-14 SMART
ZnF_C2H2 155 175 2.82e1 SMART
ZnF_C2H2 287 309 1.1e-2 SMART
ZnF_C2H2 315 337 2.24e-3 SMART
ZnF_C2H2 343 365 5.14e-3 SMART
ZnF_C2H2 371 393 4.79e-3 SMART
ZnF_C2H2 399 421 1.12e-3 SMART
ZnF_C2H2 427 449 5.14e-3 SMART
ZnF_C2H2 455 477 7.37e-4 SMART
ZnF_C2H2 483 505 4.87e-4 SMART
ZnF_C2H2 511 533 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189452
AA Change: N314S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000139791
Gene: ENSMUSG00000062101
AA Change: N314S

DomainStartEndE-ValueType
Blast:KRAB 1 34 8e-11 BLAST
ZnF_C2H2 123 143 1.2e-1 SMART
ZnF_C2H2 255 277 4.7e-5 SMART
ZnF_C2H2 283 305 9.1e-6 SMART
ZnF_C2H2 311 333 2.2e-5 SMART
ZnF_C2H2 339 361 2e-5 SMART
ZnF_C2H2 367 389 4.7e-6 SMART
ZnF_C2H2 395 417 2.1e-5 SMART
ZnF_C2H2 423 445 3.2e-6 SMART
ZnF_C2H2 451 473 2e-6 SMART
ZnF_C2H2 479 501 5.2e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Zfp119b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Zfp119b APN 17 55939270 missense probably damaging 1.00
IGL01868:Zfp119b APN 17 55939866 missense possibly damaging 0.70
IGL02623:Zfp119b APN 17 55939793 missense probably damaging 0.96
R0377:Zfp119b UTSW 17 55938671 missense probably damaging 1.00
R1833:Zfp119b UTSW 17 55939271 missense probably damaging 1.00
R2177:Zfp119b UTSW 17 55938639 missense probably damaging 1.00
R2297:Zfp119b UTSW 17 55939355 missense possibly damaging 0.46
R4273:Zfp119b UTSW 17 55938926 missense possibly damaging 0.79
R4801:Zfp119b UTSW 17 55939642 missense probably damaging 0.96
R4802:Zfp119b UTSW 17 55939642 missense probably damaging 0.96
R6525:Zfp119b UTSW 17 55939992 missense possibly damaging 0.96
R6950:Zfp119b UTSW 17 55939137 missense probably damaging 1.00
R6974:Zfp119b UTSW 17 55938564 missense probably benign 0.02
R7750:Zfp119b UTSW 17 55938682 missense probably damaging 1.00
RF020:Zfp119b UTSW 17 55939499 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTCATTTCTTAGATTGCTGGGG -3'
(R):5'- GTAGGTAGAACTAATACTAGAGACACA -3'

Sequencing Primer
(F):5'- AAAGGCTTTCCCACACTGATTG -3'
(R):5'- GGGGTAAAGCCTTTACATATCCCAG -3'
Posted On2018-06-22