Incidental Mutation 'R6644:Stx5a'
ID526044
Institutional Source Beutler Lab
Gene Symbol Stx5a
Ensembl Gene ENSMUSG00000010110
Gene Namesyntaxin 5A
SynonymsD19Ertd627e, 0610031F24Rik, syntaxin 5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6644 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8741413-8756069 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 8755248 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010241] [ENSMUST00000010254] [ENSMUST00000073430] [ENSMUST00000175872] [ENSMUST00000176013] [ENSMUST00000176381] [ENSMUST00000176968] [ENSMUST00000177322] [ENSMUST00000177373] [ENSMUST00000184970] [ENSMUST00000183939] [ENSMUST00000184756]
Predicted Effect probably benign
Transcript: ENSMUST00000010241
SMART Domains Protein: ENSMUSP00000010241
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 115 198 7.6e-42 PFAM
low complexity region 258 274 N/A INTRINSIC
LRRcap 333 351 1.44e0 SMART
Pfam:NTF2 385 535 1.3e-29 PFAM
TAP_C 555 618 1.85e-33 SMART
Predicted Effect unknown
Transcript: ENSMUST00000010254
AA Change: Y427F
SMART Domains Protein: ENSMUSP00000010254
Gene: ENSMUSG00000010110
AA Change: Y427F

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin-5_N 52 74 1.5e-15 PFAM
SCOP:d1fioa_ 92 298 7e-36 SMART
Blast:t_SNARE 258 304 9e-22 BLAST
low complexity region 346 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073430
SMART Domains Protein: ENSMUSP00000073136
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 1e-15 PFAM
t_SNARE 258 325 4.33e-15 SMART
transmembrane domain 334 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175872
SMART Domains Protein: ENSMUSP00000135416
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 2.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176013
SMART Domains Protein: ENSMUSP00000135465
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 143 3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176182
Predicted Effect probably benign
Transcript: ENSMUST00000176381
SMART Domains Protein: ENSMUSP00000134854
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 1e-15 PFAM
t_SNARE 258 325 4.33e-15 SMART
transmembrane domain 334 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176404
Predicted Effect probably benign
Transcript: ENSMUST00000176968
SMART Domains Protein: ENSMUSP00000135468
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
t_SNARE 12 79 4.33e-15 SMART
transmembrane domain 88 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177322
SMART Domains Protein: ENSMUSP00000135624
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177373
SMART Domains Protein: ENSMUSP00000134794
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
Pfam:Syntaxin 1 98 5.2e-15 PFAM
t_SNARE 162 229 4.33e-15 SMART
transmembrane domain 238 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183780
Predicted Effect probably benign
Transcript: ENSMUST00000184970
SMART Domains Protein: ENSMUSP00000139124
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 112 199 2.4e-45 PFAM
low complexity region 258 274 N/A INTRINSIC
Pfam:LRR_1 291 314 3.2e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183939
SMART Domains Protein: ENSMUSP00000139351
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
Pfam:Tap-RNA_bind 1 63 5.7e-28 PFAM
low complexity region 122 138 N/A INTRINSIC
Pfam:LRR_1 155 178 2.1e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184756
SMART Domains Protein: ENSMUSP00000139050
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for v-SNAREs (vesicle-SNAP receptors), permitting specific synaptic vesicle docking and fusion. The encoded protein regulates endoplasmic reticulum to Golgi transport and plays a critical role in autophagy. Autoantibodies targeting the encoded protein may be a diagnostic marker for endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,922 I130S probably damaging Het
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M75K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F26L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in Stx5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03152:Stx5a APN 19 8749774 critical splice donor site probably null
R0541:Stx5a UTSW 19 8749937 missense probably damaging 1.00
R0726:Stx5a UTSW 19 8754911 missense probably damaging 1.00
R1566:Stx5a UTSW 19 8742311 missense probably damaging 0.99
R1990:Stx5a UTSW 19 8748890 critical splice donor site probably null
R2852:Stx5a UTSW 19 8755112 unclassified probably benign
R3022:Stx5a UTSW 19 8755154 unclassified probably benign
R4426:Stx5a UTSW 19 8749740 missense probably benign 0.02
R4684:Stx5a UTSW 19 8743361 missense probably damaging 0.96
R5594:Stx5a UTSW 19 8748465 missense probably damaging 1.00
R5750:Stx5a UTSW 19 8755137 unclassified probably benign
R5929:Stx5a UTSW 19 8742311 missense probably damaging 0.99
R6983:Stx5a UTSW 19 8755169 unclassified probably benign
R7242:Stx5a UTSW 19 8755277 missense unknown
R7258:Stx5a UTSW 19 8754907 critical splice acceptor site probably null
R7464:Stx5a UTSW 19 8743504 unclassified probably benign
R7871:Stx5a UTSW 19 8755118 missense unknown
R7880:Stx5a UTSW 19 8742328 missense probably damaging 1.00
R7980:Stx5a UTSW 19 8742438 missense probably damaging 1.00
R8375:Stx5a UTSW 19 8755098 missense unknown
X0020:Stx5a UTSW 19 8748890 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TCATTCTGAGCCACTCCATG -3'
(R):5'- CCCAGATGATGAAGTTGGTCCC -3'

Sequencing Primer
(F):5'- ACTCCATGGAGGGCTTGG -3'
(R):5'- CTCTCAAGAAGGAAGGGCGTTTTC -3'
Posted On2018-06-22