Incidental Mutation 'R6645:Satb2'
ID526048
Institutional Source Beutler Lab
Gene Symbol Satb2
Ensembl Gene ENSMUSG00000038331
Gene Namespecial AT-rich sequence binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6645 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location56793981-56978650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56797007 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 542 (I542V)
Ref Sequence ENSEMBL: ENSMUSP00000135391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042857] [ENSMUST00000114415] [ENSMUST00000177424]
Predicted Effect probably benign
Transcript: ENSMUST00000042857
AA Change: I601V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000046067
Gene: ENSMUSG00000038331
AA Change: I601V

DomainStartEndE-ValueType
PDB:3TUO|D 45 98 8e-19 PDB
PDB:3NZL|A 106 174 4e-35 PDB
low complexity region 235 251 N/A INTRINSIC
CUT 292 378 1.3e-36 SMART
low complexity region 381 399 N/A INTRINSIC
CUT 415 501 3.58e-39 SMART
low complexity region 510 524 N/A INTRINSIC
low complexity region 533 551 N/A INTRINSIC
HOX 555 618 1.06e-7 SMART
low complexity region 629 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114415
AA Change: I660V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110057
Gene: ENSMUSG00000038331
AA Change: I660V

DomainStartEndE-ValueType
Pfam:ULD 58 156 1.7e-39 PFAM
Pfam:CUTL 162 233 3.9e-46 PFAM
low complexity region 294 310 N/A INTRINSIC
CUT 351 437 1.3e-36 SMART
low complexity region 440 458 N/A INTRINSIC
CUT 474 560 3.58e-39 SMART
low complexity region 569 583 N/A INTRINSIC
low complexity region 592 610 N/A INTRINSIC
HOX 614 677 1.06e-7 SMART
low complexity region 688 709 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177424
AA Change: I542V

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135391
Gene: ENSMUSG00000038331
AA Change: I542V

DomainStartEndE-ValueType
PDB:3TUO|D 57 115 6e-23 PDB
low complexity region 176 192 N/A INTRINSIC
CUT 233 319 1.3e-36 SMART
low complexity region 322 340 N/A INTRINSIC
CUT 356 442 3.58e-39 SMART
low complexity region 451 465 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
HOX 496 559 1.06e-7 SMART
low complexity region 570 591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA binding protein that specifically binds nuclear matrix attachment regions. The encoded protein is involved in transcription regulation and chromatin remodeling. Defects in this gene are associated with isolated cleft palate and mental retardation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation of this gene causes complete perinatal lethality and craniofacial anomalies, such as cleft palate, micrognathia, microcephaly, decreased tongue size, absent incisors and nasal capsule hypoplasia, and leads to short limbs and defects in osteoblast differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,117 D994V probably benign Het
Anp32e T A 3: 95,937,102 F95I probably damaging Het
Arap1 A G 7: 101,408,111 K628R possibly damaging Het
Arid4b A T 13: 14,120,152 E6D probably damaging Het
Atxn10 G T 15: 85,376,703 probably null Het
Ccdc170 A G 10: 4,560,974 I678V possibly damaging Het
Ccdc18 T A 5: 108,138,930 V110D probably benign Het
Cep85l C T 10: 53,301,672 E322K probably benign Het
Cilp A T 9: 65,279,305 Y894F possibly damaging Het
Ddx4 A G 13: 112,641,174 S62P possibly damaging Het
Dph7 T C 2: 24,965,651 V154A probably benign Het
Ephb6 T C 6: 41,617,272 S579P probably benign Het
Fam53a G T 5: 33,600,784 Q332K probably benign Het
Fancm A G 12: 65,106,100 D1110G probably damaging Het
Fh1 A T 1: 175,614,876 V136E possibly damaging Het
Greb1 G T 12: 16,698,579 H1132Q probably benign Het
Jph1 A G 1: 17,091,761 S226P probably damaging Het
Kbtbd8 C T 6: 95,126,749 R460* probably null Het
Lama5 T A 2: 180,179,670 N3059Y probably damaging Het
Lipc G A 9: 70,803,748 T289I probably damaging Het
Lrrc2 T C 9: 110,970,107 W241R probably damaging Het
Mfn2 T A 4: 147,894,612 I88F probably damaging Het
Mms19 G C 19: 41,955,191 N366K probably benign Het
Myo15 A G 11: 60,477,292 T293A probably benign Het
Ndfip2 T A 14: 105,292,273 Y179N probably damaging Het
Notch4 A G 17: 34,587,816 D1909G probably benign Het
Obscn C T 11: 59,085,262 S2013N probably damaging Het
Oca2 G T 7: 56,314,774 A357S probably benign Het
Olfr902 T C 9: 38,448,923 L17S probably damaging Het
Olfr955 T A 9: 39,470,266 L153F probably benign Het
Pde7b C A 10: 20,610,566 probably null Het
Ppef2 T C 5: 92,230,461 N625S probably benign Het
Prom1 A T 5: 44,047,514 L192Q probably damaging Het
Sgpp2 C T 1: 78,360,162 T59M probably damaging Het
Skint6 T C 4: 112,892,038 T782A possibly damaging Het
Slc13a4 G T 6: 35,268,839 Q624K probably benign Het
Slc9a3 T A 13: 74,164,172 H629Q probably damaging Het
Slitrk3 G T 3: 73,049,861 A526E probably benign Het
Sptssa T C 12: 54,646,490 Y53C probably damaging Het
Srsf10 T C 4: 135,863,563 S159P possibly damaging Het
Tbce T C 13: 14,005,229 T341A probably benign Het
Tdrd6 A G 17: 43,624,532 L1875P probably benign Het
Tkt G A 14: 30,570,211 G425R probably damaging Het
Tmprss7 T C 16: 45,690,963 I17M possibly damaging Het
Ttc21b T C 2: 66,236,377 S311G probably benign Het
Ubr5 A G 15: 38,029,506 Y492H probably damaging Het
Ush2a T C 1: 188,523,331 I1535T probably damaging Het
Vmn2r17 A T 5: 109,428,381 N373Y probably damaging Het
Vmn2r6 A T 3: 64,556,876 V179E probably damaging Het
Vps13b A G 15: 35,910,305 E3405G probably benign Het
Wac A T 18: 7,973,523 Q212H probably damaging Het
Washc4 C T 10: 83,572,195 R555* probably null Het
Zmat4 G A 8: 23,797,401 probably null Het
Other mutations in Satb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Satb2 APN 1 56831541 missense possibly damaging 0.56
IGL02008:Satb2 APN 1 56796793 missense possibly damaging 0.70
IGL02209:Satb2 APN 1 56871518 missense probably damaging 1.00
IGL02956:Satb2 APN 1 56948175 missense probably damaging 0.99
IGL03214:Satb2 APN 1 56845580 missense probably damaging 1.00
IGL03272:Satb2 APN 1 56845643 missense probably damaging 1.00
IGL03356:Satb2 APN 1 56891174 missense probably damaging 1.00
R0990:Satb2 UTSW 1 56850184 missense probably damaging 0.96
R1534:Satb2 UTSW 1 56948233 nonsense probably null
R1711:Satb2 UTSW 1 56850289 missense probably damaging 0.99
R1952:Satb2 UTSW 1 56899070 missense probably damaging 1.00
R2404:Satb2 UTSW 1 56948108 missense probably damaging 1.00
R3792:Satb2 UTSW 1 56845620 missense probably damaging 1.00
R3870:Satb2 UTSW 1 56891220 missense probably damaging 1.00
R3871:Satb2 UTSW 1 56891220 missense probably damaging 1.00
R4333:Satb2 UTSW 1 56845586 missense probably damaging 1.00
R4621:Satb2 UTSW 1 56845619 missense probably damaging 1.00
R4962:Satb2 UTSW 1 56891168 missense probably benign 0.25
R5296:Satb2 UTSW 1 56796907 missense probably damaging 0.99
R5314:Satb2 UTSW 1 56831527 missense probably damaging 0.99
R5407:Satb2 UTSW 1 56948150 missense probably damaging 1.00
R5925:Satb2 UTSW 1 56796938 missense possibly damaging 0.80
R6355:Satb2 UTSW 1 56948197 missense probably damaging 1.00
R6634:Satb2 UTSW 1 56845721 nonsense probably null
R7578:Satb2 UTSW 1 56871784 missense probably benign 0.01
R7694:Satb2 UTSW 1 56871524 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTGCGGAGTTCACATTATC -3'
(R):5'- AGTCCCAGCCAACTAAGGAG -3'

Sequencing Primer
(F):5'- CGGAGTTCACATTATCTCTGGTCG -3'
(R):5'- CAGCCAACTAAGGAGAGCTC -3'
Posted On2018-06-22