Mutagenetix > Incidental Mutations

Incidental Mutation 'R6645:Greb1'

526083

Institutional Source

Beutler Lab

Gene Symbol

Greb1

Ensembl Gene

ENSMUSG00000036523

Gene Name

gene regulated by estrogen in breast cancer protein

Synonyms

5730583K22Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6645 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

16670615-16800886 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 16698579 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1132 (H1132Q)

Ref Sequence

ENSEMBL: ENSMUSP00000124348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]

Predicted Effect

probably benign
Transcript: ENSMUST00000048064
AA Change: H1132Q

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: H1132Q

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1954	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159120
AA Change: H1104Q

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: H1104Q

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1100	1118	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1596	1607	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161036

Predicted Effect

probably benign
Transcript: ENSMUST00000162112
AA Change: H1132Q

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: H1132Q

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1128	1146	N/A	INTRINSIC
low complexity region	1224	1235	N/A	INTRINSIC
low complexity region	1279	1293	N/A	INTRINSIC
low complexity region	1624	1635	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	A	1: 26,683,117	D994V	probably benign	Het
Anp32e	T	A	3: 95,937,102	F95I	probably damaging	Het
Arap1	A	G	7: 101,408,111	K628R	possibly damaging	Het
Arid4b	A	T	13: 14,120,152	E6D	probably damaging	Het
Atxn10	G	T	15: 85,376,703		probably null	Het
Ccdc170	A	G	10: 4,560,974	I678V	possibly damaging	Het
Ccdc18	T	A	5: 108,138,930	V110D	probably benign	Het
Cep85l	C	T	10: 53,301,672	E322K	probably benign	Het
Cilp	A	T	9: 65,279,305	Y894F	possibly damaging	Het
Ddx4	A	G	13: 112,641,174	S62P	possibly damaging	Het
Dph7	T	C	2: 24,965,651	V154A	probably benign	Het
Ephb6	T	C	6: 41,617,272	S579P	probably benign	Het
Fam53a	G	T	5: 33,600,784	Q332K	probably benign	Het
Fancm	A	G	12: 65,106,100	D1110G	probably damaging	Het
Fh1	A	T	1: 175,614,876	V136E	possibly damaging	Het
Jph1	A	G	1: 17,091,761	S226P	probably damaging	Het
Kbtbd8	C	T	6: 95,126,749	R460*	probably null	Het
Lama5	T	A	2: 180,179,670	N3059Y	probably damaging	Het
Lipc	G	A	9: 70,803,748	T289I	probably damaging	Het
Lrrc2	T	C	9: 110,970,107	W241R	probably damaging	Het
Mfn2	T	A	4: 147,894,612	I88F	probably damaging	Het
Mms19	G	C	19: 41,955,191	N366K	probably benign	Het
Myo15	A	G	11: 60,477,292	T293A	probably benign	Het
Ndfip2	T	A	14: 105,292,273	Y179N	probably damaging	Het
Notch4	A	G	17: 34,587,816	D1909G	probably benign	Het
Obscn	C	T	11: 59,085,262	S2013N	probably damaging	Het
Oca2	G	T	7: 56,314,774	A357S	probably benign	Het
Olfr902	T	C	9: 38,448,923	L17S	probably damaging	Het
Olfr955	T	A	9: 39,470,266	L153F	probably benign	Het
Pde7b	C	A	10: 20,610,566		probably null	Het
Ppef2	T	C	5: 92,230,461	N625S	probably benign	Het
Prom1	A	T	5: 44,047,514	L192Q	probably damaging	Het
Satb2	T	C	1: 56,797,007	I542V	possibly damaging	Het
Sgpp2	C	T	1: 78,360,162	T59M	probably damaging	Het
Skint6	T	C	4: 112,892,038	T782A	possibly damaging	Het
Slc13a4	G	T	6: 35,268,839	Q624K	probably benign	Het
Slc9a3	T	A	13: 74,164,172	H629Q	probably damaging	Het
Slitrk3	G	T	3: 73,049,861	A526E	probably benign	Het
Sptssa	T	C	12: 54,646,490	Y53C	probably damaging	Het
Srsf10	T	C	4: 135,863,563	S159P	possibly damaging	Het
Tbce	T	C	13: 14,005,229	T341A	probably benign	Het
Tdrd6	A	G	17: 43,624,532	L1875P	probably benign	Het
Tkt	G	A	14: 30,570,211	G425R	probably damaging	Het
Tmprss7	T	C	16: 45,690,963	I17M	possibly damaging	Het
Ttc21b	T	C	2: 66,236,377	S311G	probably benign	Het
Ubr5	A	G	15: 38,029,506	Y492H	probably damaging	Het
Ush2a	T	C	1: 188,523,331	I1535T	probably damaging	Het
Vmn2r17	A	T	5: 109,428,381	N373Y	probably damaging	Het
Vmn2r6	A	T	3: 64,556,876	V179E	probably damaging	Het
Vps13b	A	G	15: 35,910,305	E3405G	probably benign	Het
Wac	A	T	18: 7,973,523	Q212H	probably damaging	Het
Washc4	C	T	10: 83,572,195	R555*	probably null	Het
Zmat4	G	A	8: 23,797,401		probably null	Het

Other mutations in Greb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Greb1	APN	12	16711961	missense	probably damaging	1.00
IGL01316:Greb1	APN	12	16698586	missense	probably benign	0.04
IGL01464:Greb1	APN	12	16714826	missense	probably damaging	0.99
IGL01474:Greb1	APN	12	16684501	missense	probably benign
IGL01522:Greb1	APN	12	16701201	missense	probably damaging	1.00
IGL01824:Greb1	APN	12	16711716	nonsense	probably null
IGL01837:Greb1	APN	12	16684451	missense	probably benign	0.19
IGL01991:Greb1	APN	12	16699681	missense	probably damaging	1.00
IGL01996:Greb1	APN	12	16690845	missense	possibly damaging	0.70
IGL02213:Greb1	APN	12	16706232	missense	probably damaging	1.00
IGL02267:Greb1	APN	12	16717208	missense	probably benign	0.00
IGL02512:Greb1	APN	12	16692712	missense	possibly damaging	0.79
IGL02583:Greb1	APN	12	16706295	splice site	probably benign
IGL02613:Greb1	APN	12	16739888	critical splice donor site	probably null
IGL02648:Greb1	APN	12	16708682	missense	probably damaging	1.00
IGL02679:Greb1	APN	12	16708723	missense	probably damaging	1.00
Eared	UTSW	12	16673863	missense	probably damaging	1.00
Humpback	UTSW	12	16701171	missense	probably damaging	1.00
pied_billed	UTSW	12	16724857	missense	possibly damaging	0.79
G1patch:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
IGL03048:Greb1	UTSW	12	16733331	missense	probably damaging	1.00
R0083:Greb1	UTSW	12	16696451	missense	probably benign
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0220:Greb1	UTSW	12	16682286	missense	probably damaging	1.00
R0245:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0540:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0547:Greb1	UTSW	12	16723411	missense	probably benign
R0563:Greb1	UTSW	12	16680267	missense	probably benign	0.23
R0607:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0610:Greb1	UTSW	12	16696442	missense	probably benign
R0652:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0659:Greb1	UTSW	12	16680212	missense	probably damaging	0.99
R0945:Greb1	UTSW	12	16673802	missense	probably benign	0.31
R1055:Greb1	UTSW	12	16682251	missense	probably damaging	0.98
R1445:Greb1	UTSW	12	16707851	missense	probably damaging	1.00
R1471:Greb1	UTSW	12	16711774	missense	probably damaging	0.97
R1503:Greb1	UTSW	12	16724819	nonsense	probably null
R1566:Greb1	UTSW	12	16711828	missense	possibly damaging	0.94
R1614:Greb1	UTSW	12	16701171	missense	probably damaging	1.00
R1623:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R1751:Greb1	UTSW	12	16723438	splice site	probably benign
R1778:Greb1	UTSW	12	16690894	missense	probably benign
R1842:Greb1	UTSW	12	16696243	missense	probably damaging	1.00
R2040:Greb1	UTSW	12	16702650	missense	probably damaging	1.00
R2153:Greb1	UTSW	12	16699532	missense	probably damaging	1.00
R2178:Greb1	UTSW	12	16696387	missense	probably damaging	1.00
R2194:Greb1	UTSW	12	16690908	missense	probably benign	0.08
R2248:Greb1	UTSW	12	16680378	missense	possibly damaging	0.90
R2474:Greb1	UTSW	12	16714953	missense	possibly damaging	0.93
R2509:Greb1	UTSW	12	16724922	missense	probably damaging	1.00
R2860:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2861:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2862:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2866:Greb1	UTSW	12	16699550	missense	probably damaging	1.00
R2890:Greb1	UTSW	12	16704478	missense	probably damaging	1.00
R3056:Greb1	UTSW	12	16688591	missense	probably damaging	0.96
R3863:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3864:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3956:Greb1	UTSW	12	16682299	missense	probably damaging	1.00
R4493:Greb1	UTSW	12	16698610	missense	probably benign	0.14
R4548:Greb1	UTSW	12	16699675	missense	probably damaging	1.00
R4683:Greb1	UTSW	12	16711773	missense	possibly damaging	0.75
R4739:Greb1	UTSW	12	16696328	missense	probably damaging	1.00
R4770:Greb1	UTSW	12	16681356	missense	probably benign	0.03
R4838:Greb1	UTSW	12	16684360	critical splice donor site	probably null
R4925:Greb1	UTSW	12	16681471	missense	probably damaging	1.00
R4982:Greb1	UTSW	12	16724761	missense	probably damaging	0.98
R5009:Greb1	UTSW	12	16724857	missense	possibly damaging	0.79
R5086:Greb1	UTSW	12	16708022	intron	probably benign
R5213:Greb1	UTSW	12	16714790	nonsense	probably null
R5310:Greb1	UTSW	12	16716759	missense	probably benign	0.09
R5353:Greb1	UTSW	12	16688566	nonsense	probably null
R5544:Greb1	UTSW	12	16673796	missense	probably damaging	1.00
R5605:Greb1	UTSW	12	16708726	missense	probably damaging	0.96
R5708:Greb1	UTSW	12	16673842	missense	probably benign	0.11
R5837:Greb1	UTSW	12	16688585	missense	probably damaging	1.00
R5890:Greb1	UTSW	12	16733421	missense	possibly damaging	0.90
R5938:Greb1	UTSW	12	16717258	missense	probably damaging	1.00
R6049:Greb1	UTSW	12	16681394	missense	probably damaging	0.99
R6093:Greb1	UTSW	12	16684486	missense	probably benign
R6120:Greb1	UTSW	12	16708621	missense	probably damaging	0.99
R6175:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R6247:Greb1	UTSW	12	16716675	missense	probably damaging	1.00
R6274:Greb1	UTSW	12	16735151	missense	probably damaging	0.97
R6376:Greb1	UTSW	12	16699579	missense	probably damaging	0.97
R6523:Greb1	UTSW	12	16684373	missense	possibly damaging	0.51
R6557:Greb1	UTSW	12	16710383	missense	probably benign	0.00
R6602:Greb1	UTSW	12	16709440	missense	probably benign	0.44
R6621:Greb1	UTSW	12	16692717	missense	probably damaging	1.00
R6725:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
R6750:Greb1	UTSW	12	16688583	missense	probably benign	0.05
R6863:Greb1	UTSW	12	16684420	missense	probably damaging	1.00
R6914:Greb1	UTSW	12	16707902	missense	probably damaging	0.97
R6996:Greb1	UTSW	12	16723354	missense	probably benign	0.00
R7083:Greb1	UTSW	12	16723314	missense	probably benign
R7147:Greb1	UTSW	12	16733427	missense	probably damaging	1.00
R7238:Greb1	UTSW	12	16674672	missense	probably damaging	0.99
R7290:Greb1	UTSW	12	16711738	missense	probably damaging	1.00
R7358:Greb1	UTSW	12	16724881	missense	probably damaging	1.00
R7395:Greb1	UTSW	12	16709430	critical splice donor site	probably null
R7526:Greb1	UTSW	12	16716765	missense	probably benign	0.00
R7530:Greb1	UTSW	12	16717206	missense	probably benign	0.02
R7536:Greb1	UTSW	12	16682185	missense	probably damaging	1.00
R7643:Greb1	UTSW	12	16711996	missense	probably damaging	0.99
R7732:Greb1	UTSW	12	16673863	missense	probably damaging	1.00
R7740:Greb1	UTSW	12	16740121	start gained	probably benign
R7747:Greb1	UTSW	12	16674795	missense	probably benign	0.01
R7760:Greb1	UTSW	12	16723416	missense	probably benign
R7937:Greb1	UTSW	12	16716669	missense	probably damaging	0.99
R8043:Greb1	UTSW	12	16711789	missense	probably damaging	1.00
R8259:Greb1	UTSW	12	16724924	nonsense	probably null
R8553:Greb1	UTSW	12	16723327	missense	probably benign	0.00
R8559:Greb1	UTSW	12	16696435	missense	probably damaging	1.00
R8690:Greb1	UTSW	12	16696547	missense	probably benign	0.03
R8830:Greb1	UTSW	12	16688519	missense	probably benign	0.35
Z1176:Greb1	UTSW	12	16696756	missense	probably benign	0.00
Z1177:Greb1	UTSW	12	16702491	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTGTCCAGTTAGTTCTAGGC -3'
(R):5'- TCTGTTGTGAGCTCAGTCTAGC -3'

Sequencing Primer
(F):5'- GTTCTAGGCTATTCTTGAATCAGTTC -3'
(R):5'- GCTCAGTCTAGCTAAGGGTG -3'

Posted On

2018-06-22