Incidental Mutation 'R6645:Tkt'
ID526090
Institutional Source Beutler Lab
Gene Symbol Tkt
Ensembl Gene ENSMUSG00000021957
Gene Nametransketolase
Synonymsp68
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6645 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location30548359-30574720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30570211 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 425 (G425R)
Ref Sequence ENSEMBL: ENSMUSP00000022529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022529]
Predicted Effect probably damaging
Transcript: ENSMUST00000022529
AA Change: G425R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022529
Gene: ENSMUSG00000021957
AA Change: G425R

DomainStartEndE-ValueType
Pfam:Transketolase_N 14 284 1.4e-46 PFAM
Pfam:E1_dh 108 239 6.9e-11 PFAM
Transket_pyr 315 479 1.52e-42 SMART
Pfam:Transketolase_C 490 612 3.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223633
Predicted Effect unknown
Transcript: ENSMUST00000223717
AA Change: G303R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225857
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that binds magnesium and thiamine pyrophosphate and catalyzes the transfer of sugar phosphates to an aldose acceptor. This enzyme is a key component of the pentose phosphate pathway during glycolysis. It is significantly expressed in the cornea and may be involved in the cellular response against oxidative stress. Haploinsufficiency of this gene leads to decreased growth and reduction of adipose tissue. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation die at or before the morula stage. Heterozygotes show reduced growth, decreased fat accumulation, microphthalmia, and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,117 D994V probably benign Het
Anp32e T A 3: 95,937,102 F95I probably damaging Het
Arap1 A G 7: 101,408,111 K628R possibly damaging Het
Arid4b A T 13: 14,120,152 E6D probably damaging Het
Atxn10 G T 15: 85,376,703 probably null Het
Ccdc170 A G 10: 4,560,974 I678V possibly damaging Het
Ccdc18 T A 5: 108,138,930 V110D probably benign Het
Cep85l C T 10: 53,301,672 E322K probably benign Het
Cilp A T 9: 65,279,305 Y894F possibly damaging Het
Ddx4 A G 13: 112,641,174 S62P possibly damaging Het
Dph7 T C 2: 24,965,651 V154A probably benign Het
Ephb6 T C 6: 41,617,272 S579P probably benign Het
Fam53a G T 5: 33,600,784 Q332K probably benign Het
Fancm A G 12: 65,106,100 D1110G probably damaging Het
Fh1 A T 1: 175,614,876 V136E possibly damaging Het
Greb1 G T 12: 16,698,579 H1132Q probably benign Het
Jph1 A G 1: 17,091,761 S226P probably damaging Het
Kbtbd8 C T 6: 95,126,749 R460* probably null Het
Lama5 T A 2: 180,179,670 N3059Y probably damaging Het
Lipc G A 9: 70,803,748 T289I probably damaging Het
Lrrc2 T C 9: 110,970,107 W241R probably damaging Het
Mfn2 T A 4: 147,894,612 I88F probably damaging Het
Mms19 G C 19: 41,955,191 N366K probably benign Het
Myo15 A G 11: 60,477,292 T293A probably benign Het
Ndfip2 T A 14: 105,292,273 Y179N probably damaging Het
Notch4 A G 17: 34,587,816 D1909G probably benign Het
Obscn C T 11: 59,085,262 S2013N probably damaging Het
Oca2 G T 7: 56,314,774 A357S probably benign Het
Olfr902 T C 9: 38,448,923 L17S probably damaging Het
Olfr955 T A 9: 39,470,266 L153F probably benign Het
Pde7b C A 10: 20,610,566 probably null Het
Ppef2 T C 5: 92,230,461 N625S probably benign Het
Prom1 A T 5: 44,047,514 L192Q probably damaging Het
Satb2 T C 1: 56,797,007 I542V possibly damaging Het
Sgpp2 C T 1: 78,360,162 T59M probably damaging Het
Skint6 T C 4: 112,892,038 T782A possibly damaging Het
Slc13a4 G T 6: 35,268,839 Q624K probably benign Het
Slc9a3 T A 13: 74,164,172 H629Q probably damaging Het
Slitrk3 G T 3: 73,049,861 A526E probably benign Het
Sptssa T C 12: 54,646,490 Y53C probably damaging Het
Srsf10 T C 4: 135,863,563 S159P possibly damaging Het
Tbce T C 13: 14,005,229 T341A probably benign Het
Tdrd6 A G 17: 43,624,532 L1875P probably benign Het
Tmprss7 T C 16: 45,690,963 I17M possibly damaging Het
Ttc21b T C 2: 66,236,377 S311G probably benign Het
Ubr5 A G 15: 38,029,506 Y492H probably damaging Het
Ush2a T C 1: 188,523,331 I1535T probably damaging Het
Vmn2r17 A T 5: 109,428,381 N373Y probably damaging Het
Vmn2r6 A T 3: 64,556,876 V179E probably damaging Het
Vps13b A G 15: 35,910,305 E3405G probably benign Het
Wac A T 18: 7,973,523 Q212H probably damaging Het
Washc4 C T 10: 83,572,195 R555* probably null Het
Zmat4 G A 8: 23,797,401 probably null Het
Other mutations in Tkt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tkt APN 14 30569095 missense probably damaging 1.00
IGL02122:Tkt APN 14 30571201 missense possibly damaging 0.95
IGL02323:Tkt APN 14 30571035 missense possibly damaging 0.69
IGL02326:Tkt APN 14 30572225 missense probably damaging 0.99
IGL02554:Tkt APN 14 30558780 missense probably damaging 1.00
IGL03145:Tkt APN 14 30560688 splice site probably benign
R0148:Tkt UTSW 14 30572220 missense probably damaging 1.00
R0732:Tkt UTSW 14 30571140 splice site probably null
R1550:Tkt UTSW 14 30565568 missense probably damaging 1.00
R2218:Tkt UTSW 14 30567061 critical splice donor site probably null
R4464:Tkt UTSW 14 30568274 missense possibly damaging 0.86
R4771:Tkt UTSW 14 30567025 missense probably damaging 0.97
R4998:Tkt UTSW 14 30565542 nonsense probably null
R5123:Tkt UTSW 14 30565646 missense probably benign 0.11
R5240:Tkt UTSW 14 30565678 missense probably damaging 1.00
R5283:Tkt UTSW 14 30560618 missense probably damaging 1.00
R5777:Tkt UTSW 14 30558776 missense possibly damaging 0.88
R6051:Tkt UTSW 14 30568196 missense probably benign 0.27
R6517:Tkt UTSW 14 30549323 missense probably damaging 0.96
R6722:Tkt UTSW 14 30569084 missense probably damaging 1.00
R7120:Tkt UTSW 14 30559822 missense probably benign 0.03
R7179:Tkt UTSW 14 30559858 missense probably damaging 1.00
R7272:Tkt UTSW 14 30565607 missense probably damaging 1.00
R7274:Tkt UTSW 14 30569145 splice site probably null
R7402:Tkt UTSW 14 30558798 missense probably damaging 1.00
R7423:Tkt UTSW 14 30571035 missense possibly damaging 0.69
R7522:Tkt UTSW 14 30568223 missense possibly damaging 0.52
R7712:Tkt UTSW 14 30558806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGCAGTACTTTCGCGG -3'
(R):5'- AAGTGACCAGCTCTACCTTGC -3'

Sequencing Primer
(F):5'- ACGGGCCTTCGACCAGATTC -3'
(R):5'- AGCTCTACCTTGCGCTGG -3'
Posted On2018-06-22