Mutagenetix > Incidental Mutations

Incidental Mutation 'R6647:Eprs'

526104

Institutional Source

Beutler Lab

Gene Symbol

Eprs

Ensembl Gene

ENSMUSG00000026615

Gene Name

glutamyl-prolyl-tRNA synthetase

Synonyms

2410081F06Rik, 3010002K18Rik, Qprs

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6647 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

185363044-185428360 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 185414424 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1217 (A1217V)

Ref Sequence

ENSEMBL: ENSMUSP00000045841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046514]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046514
AA Change: A1217V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045841
Gene: ENSMUSG00000026615
AA Change: A1217V

Domain	Start	End	E-Value	Type
Pfam:GST_C_3	71	156	2.1e-15	PFAM
Pfam:GST_C	72	157	2.9e-7	PFAM
Pfam:tRNA-synt_1c	197	502	8.8e-127	PFAM
Pfam:tRNA-synt_1c_C	504	681	4.4e-42	PFAM
WHEP-TRS	753	815	1.26e-25	SMART
WHEP-TRS	826	888	1.47e-26	SMART
WHEP-TRS	904	966	3.76e-24	SMART
low complexity region	984	1011	N/A	INTRINSIC
Pfam:tRNA-synt_2b	1107	1287	3.1e-17	PFAM
Pfam:HGTP_anticodon	1303	1404	1.7e-19	PFAM
ProRS-C_1	1430	1512	5.27e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192284

Meta Mutation Damage Score

0.2865

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a multifunctional aminoacyl-tRNA synthetase that catalyzes the aminoacylation of glutamic acid and proline tRNA species. Alternative splicing has been observed for this gene, but the full-length nature and biological validity of the variant have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a phospho-mimetic allele exhibit normal body weight, life span and glucose metabolism. Mice homozygous for a phospho-deficient allele exhibit decrease body weight, enhanced lipolysis, altered glucose metabolism and increased energy expenditure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	A	1: 26,682,578	N1174Y	probably damaging	Het
Agl	T	C	3: 116,750,411	T1416A	probably damaging	Het
Atp7b	A	G	8: 22,028,478	S103P	probably damaging	Het
Ces1h	A	C	8: 93,352,026	*563G	probably null	Het
Cfap157	G	T	2: 32,779,074	A339E	probably benign	Het
Crebbp	C	T	16: 4,119,806	A698T	possibly damaging	Het
Cyp2b13	A	G	7: 26,085,899	H231R	possibly damaging	Het
Ddx31	A	T	2: 28,875,738	T483S	probably damaging	Het
Defa25	A	T	8: 21,085,185	D60V	possibly damaging	Het
Dnah5	G	A	15: 28,403,487	A3453T	probably benign	Het
Dnah6	A	T	6: 73,138,760	F1500I	probably damaging	Het
Ermp1	T	C	19: 29,626,935	Y481C	probably benign	Het
Fam159a	A	G	4: 108,368,027	S113P	probably benign	Het
Fmn2	T	A	1: 174,593,104	N635K	unknown	Het
Fras1	A	G	5: 96,735,202	D2531G	probably damaging	Het
Frat1	C	T	19: 41,830,825	Q220*	probably null	Het
Gcc2	T	A	10: 58,287,281		probably null	Het
Gm3285	T	C	10: 77,862,613		probably benign	Het
Gm9857	T	C	3: 108,940,063		probably benign	Het
Grin2b	C	A	6: 135,733,110	W1146L	probably damaging	Het
Hells	T	A	19: 38,931,504	L33I	probably benign	Het
Ift81	T	A	5: 122,610,166	R54*	probably null	Het
Ints12	G	A	3: 133,096,878	R41Q	possibly damaging	Het
Katnal2	C	T	18: 76,980,037	E403K	probably benign	Het
Kcnk1	A	G	8: 125,995,460	M1V	probably null	Het
Kdm5a	A	G	6: 120,412,461	T950A	probably benign	Het
Kdr	G	A	5: 75,952,889	A773V	probably damaging	Het
Lats1	G	C	10: 7,697,507	M118I	possibly damaging	Het
Mug1	A	G	6: 121,840,241	I90V	probably benign	Het
Nid2	A	G	14: 19,802,416	D1064G	probably benign	Het
Nkx2-4	A	T	2: 147,084,267	I225N	possibly damaging	Het
Nlrp4e	A	G	7: 23,321,315	D409G	probably benign	Het
Ogfod2	G	C	5: 124,114,803	R292P	possibly damaging	Het
Olfr1163	A	T	2: 88,070,709	F224L	probably benign	Het
Olfr781	T	A	10: 129,333,164	C94*	probably null	Het
Olfr845	T	A	9: 19,338,629	H56Q	possibly damaging	Het
Olfr935	T	C	9: 38,994,914	I174V	possibly damaging	Het
Oprk1	C	T	1: 5,602,284	P215S	probably damaging	Het
Pcdhb16	A	G	18: 37,479,172	K395R	possibly damaging	Het
Ptprg	C	A	14: 11,962,714	P171T	probably damaging	Het
Pycard	T	C	7: 127,993,569	T29A	probably benign	Het
Rap1gap2	G	A	11: 74,407,928	A452V	probably benign	Het
Rasgrf1	C	G	9: 90,010,463	T1072S	probably benign	Het
Rc3h2	G	A	2: 37,382,944	R707*	probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Senp7	T	C	16: 56,173,255	I767T	probably damaging	Het
Setd7	A	G	3: 51,542,762	V81A	probably benign	Het
Shkbp1	A	G	7: 27,342,375	S685P	probably benign	Het
Snrnp200	A	G	2: 127,226,452	E904G	probably damaging	Het
Spata22	T	A	11: 73,354,700		probably null	Het
Tas2r138	G	T	6: 40,612,799	T171K	possibly damaging	Het
Tor1aip1	T	C	1: 156,018,253	D77G	possibly damaging	Het
Vav3	A	T	3: 109,527,416	H421L	probably benign	Het
Vmn1r43	A	G	6: 89,869,859	L215P	probably damaging	Het
Vmn2r100	T	A	17: 19,522,523	S386R	probably benign	Het
Xpa	T	A	4: 46,183,089	R233S	probably benign	Het

Other mutations in Eprs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00528:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00532:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00543:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00553:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00574:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00583:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00946:Eprs	APN	1	185407701	missense	probably benign	0.02
IGL01062:Eprs	APN	1	185379615	missense	probably benign	0.19
IGL01477:Eprs	APN	1	185411375	splice site	probably benign
IGL01608:Eprs	APN	1	185385114	unclassified	probably benign
IGL01767:Eprs	APN	1	185384915	missense	probably damaging	0.98
IGL02136:Eprs	APN	1	185384983	missense	probably damaging	1.00
IGL02302:Eprs	APN	1	185387124	splice site	probably benign
IGL02528:Eprs	APN	1	185413489	missense	probably damaging	1.00
IGL02631:Eprs	APN	1	185427898	missense	probably damaging	1.00
IGL02989:Eprs	APN	1	185418366	missense	probably benign	0.31
IGL03004:Eprs	APN	1	185381833	missense	probably damaging	1.00
R0003:Eprs	UTSW	1	185414391	missense	probably damaging	1.00
R0003:Eprs	UTSW	1	185414391	missense	probably damaging	1.00
R0179:Eprs	UTSW	1	185413547	missense	probably benign
R0783:Eprs	UTSW	1	185398458	missense	probably damaging	1.00
R1319:Eprs	UTSW	1	185384962	missense	probably damaging	1.00
R1335:Eprs	UTSW	1	185387089	missense	probably damaging	1.00
R1514:Eprs	UTSW	1	185381834	missense	probably damaging	0.99
R1590:Eprs	UTSW	1	185401510	missense	probably damaging	1.00
R1688:Eprs	UTSW	1	185384896	missense	probably damaging	0.99
R1725:Eprs	UTSW	1	185406992	missense	probably damaging	1.00
R2182:Eprs	UTSW	1	185379742	splice site	probably null
R2228:Eprs	UTSW	1	185367537	missense	probably damaging	1.00
R2336:Eprs	UTSW	1	185411374	splice site	probably benign
R2338:Eprs	UTSW	1	185415808	missense	probably damaging	1.00
R2439:Eprs	UTSW	1	185379742	splice site	probably null
R2914:Eprs	UTSW	1	185379742	splice site	probably null
R3001:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3002:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3003:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3547:Eprs	UTSW	1	185379742	splice site	probably null
R3775:Eprs	UTSW	1	185373008	missense	probably damaging	1.00
R3878:Eprs	UTSW	1	185415953	critical splice donor site	probably null
R3902:Eprs	UTSW	1	185379742	splice site	probably null
R3913:Eprs	UTSW	1	185379742	splice site	probably null
R4579:Eprs	UTSW	1	185401607	missense	probably damaging	1.00
R4664:Eprs	UTSW	1	185373076	intron	probably benign
R4680:Eprs	UTSW	1	185386278	missense	possibly damaging	0.87
R4712:Eprs	UTSW	1	185428108	missense	probably benign	0.00
R4749:Eprs	UTSW	1	185396130	missense	probably damaging	0.97
R4995:Eprs	UTSW	1	185410139	intron	probably benign
R5154:Eprs	UTSW	1	185413465	missense	probably damaging	1.00
R5640:Eprs	UTSW	1	185374184	missense	probably benign	0.34
R5662:Eprs	UTSW	1	185394425	missense	possibly damaging	0.72
R6037:Eprs	UTSW	1	185396109	missense	probably damaging	1.00
R6037:Eprs	UTSW	1	185396109	missense	probably damaging	1.00
R6151:Eprs	UTSW	1	185407754	critical splice donor site	probably null
R6387:Eprs	UTSW	1	185387084	missense	possibly damaging	0.94
R6701:Eprs	UTSW	1	185370890	missense	probably damaging	0.99
R6997:Eprs	UTSW	1	185396163	missense	possibly damaging	0.50
R7295:Eprs	UTSW	1	185418210	critical splice acceptor site	probably null
R7305:Eprs	UTSW	1	185379701	missense	probably damaging	1.00
R7729:Eprs	UTSW	1	185413169	missense	probably damaging	1.00
R7732:Eprs	UTSW	1	185372939	missense	probably benign	0.01
R7733:Eprs	UTSW	1	185397161	missense	probably benign
R7826:Eprs	UTSW	1	185406968	missense	probably damaging	0.96
R7988:Eprs	UTSW	1	185418348	missense	probably damaging	1.00
R8071:Eprs	UTSW	1	185394456	missense	possibly damaging	0.67
R8157:Eprs	UTSW	1	185398394	missense	probably benign	0.21
R8209:Eprs	UTSW	1	185407615	missense	possibly damaging	0.71
R8370:Eprs	UTSW	1	185399257	missense	probably damaging	0.98
R8493:Eprs	UTSW	1	185407174	nonsense	probably null
R8556:Eprs	UTSW	1	185420288	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGATTACTGTATATCGCTCAGGC -3'
(R):5'- GGTATTACTAGAGCACACACTGG -3'

Sequencing Primer
(F):5'- AGACACTTAAATGTTTCTCAGCTG -3'
(R):5'- TCATGGGCTGTGCTTAC -3'

Posted On

2018-06-22