Incidental Mutation 'R6647:Cfap157'
ID526106
Institutional Source Beutler Lab
Gene Symbol Cfap157
Ensembl Gene ENSMUSG00000038987
Gene Namecilia and flagella associated protein 157
Synonyms1700019L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6647 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32777381-32784428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32779074 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 339 (A339E)
Ref Sequence ENSEMBL: ENSMUSP00000099877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066352] [ENSMUST00000066478] [ENSMUST00000091059] [ENSMUST00000102813] [ENSMUST00000125891] [ENSMUST00000161089] [ENSMUST00000161430] [ENSMUST00000161950] [ENSMUST00000161958]
Predicted Effect probably benign
Transcript: ENSMUST00000066352
SMART Domains Protein: ENSMUSP00000068850
Gene: ENSMUSG00000053746

DomainStartEndE-ValueType
Pfam:Pept_tRNA_hydro 22 200 6.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066478
SMART Domains Protein: ENSMUSP00000068977
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091059
SMART Domains Protein: ENSMUSP00000088585
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 631 644 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102813
AA Change: A339E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099877
Gene: ENSMUSG00000038987
AA Change: A339E

DomainStartEndE-ValueType
coiled coil region 32 191 N/A INTRINSIC
coiled coil region 301 371 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123674
Predicted Effect probably benign
Transcript: ENSMUST00000125891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150918
Predicted Effect probably benign
Transcript: ENSMUST00000161089
SMART Domains Protein: ENSMUSP00000124915
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161430
SMART Domains Protein: ENSMUSP00000124031
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 596 611 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
low complexity region 686 697 N/A INTRINSIC
low complexity region 782 807 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161950
SMART Domains Protein: ENSMUSP00000123927
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192262
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Homozygous knockout males are infertile owing to reduced sperm count and reduced and abnormal sperm motility as a result of abnormal sperm morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,578 N1174Y probably damaging Het
Agl T C 3: 116,750,411 T1416A probably damaging Het
Atp7b A G 8: 22,028,478 S103P probably damaging Het
Ces1h A C 8: 93,352,026 *563G probably null Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Cyp2b13 A G 7: 26,085,899 H231R possibly damaging Het
Ddx31 A T 2: 28,875,738 T483S probably damaging Het
Defa25 A T 8: 21,085,185 D60V possibly damaging Het
Dnah5 G A 15: 28,403,487 A3453T probably benign Het
Dnah6 A T 6: 73,138,760 F1500I probably damaging Het
Eprs C T 1: 185,414,424 A1217V probably damaging Het
Ermp1 T C 19: 29,626,935 Y481C probably benign Het
Fam159a A G 4: 108,368,027 S113P probably benign Het
Fmn2 T A 1: 174,593,104 N635K unknown Het
Fras1 A G 5: 96,735,202 D2531G probably damaging Het
Frat1 C T 19: 41,830,825 Q220* probably null Het
Gcc2 T A 10: 58,287,281 probably null Het
Gm3285 T C 10: 77,862,613 probably benign Het
Gm9857 T C 3: 108,940,063 probably benign Het
Grin2b C A 6: 135,733,110 W1146L probably damaging Het
Hells T A 19: 38,931,504 L33I probably benign Het
Ift81 T A 5: 122,610,166 R54* probably null Het
Ints12 G A 3: 133,096,878 R41Q possibly damaging Het
Katnal2 C T 18: 76,980,037 E403K probably benign Het
Kcnk1 A G 8: 125,995,460 M1V probably null Het
Kdm5a A G 6: 120,412,461 T950A probably benign Het
Kdr G A 5: 75,952,889 A773V probably damaging Het
Lats1 G C 10: 7,697,507 M118I possibly damaging Het
Mug1 A G 6: 121,840,241 I90V probably benign Het
Nid2 A G 14: 19,802,416 D1064G probably benign Het
Nkx2-4 A T 2: 147,084,267 I225N possibly damaging Het
Nlrp4e A G 7: 23,321,315 D409G probably benign Het
Ogfod2 G C 5: 124,114,803 R292P possibly damaging Het
Olfr1163 A T 2: 88,070,709 F224L probably benign Het
Olfr781 T A 10: 129,333,164 C94* probably null Het
Olfr845 T A 9: 19,338,629 H56Q possibly damaging Het
Olfr935 T C 9: 38,994,914 I174V possibly damaging Het
Oprk1 C T 1: 5,602,284 P215S probably damaging Het
Pcdhb16 A G 18: 37,479,172 K395R possibly damaging Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Pycard T C 7: 127,993,569 T29A probably benign Het
Rap1gap2 G A 11: 74,407,928 A452V probably benign Het
Rasgrf1 C G 9: 90,010,463 T1072S probably benign Het
Rc3h2 G A 2: 37,382,944 R707* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Senp7 T C 16: 56,173,255 I767T probably damaging Het
Setd7 A G 3: 51,542,762 V81A probably benign Het
Shkbp1 A G 7: 27,342,375 S685P probably benign Het
Snrnp200 A G 2: 127,226,452 E904G probably damaging Het
Spata22 T A 11: 73,354,700 probably null Het
Tas2r138 G T 6: 40,612,799 T171K possibly damaging Het
Tor1aip1 T C 1: 156,018,253 D77G possibly damaging Het
Vav3 A T 3: 109,527,416 H421L probably benign Het
Vmn1r43 A G 6: 89,869,859 L215P probably damaging Het
Vmn2r100 T A 17: 19,522,523 S386R probably benign Het
Xpa T A 4: 46,183,089 R233S probably benign Het
Other mutations in Cfap157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cfap157 APN 2 32781383 missense probably damaging 1.00
IGL00852:Cfap157 APN 2 32779815 missense possibly damaging 0.89
IGL01284:Cfap157 APN 2 32781479 missense possibly damaging 0.69
IGL02315:Cfap157 APN 2 32778165 missense probably benign 0.02
PIT4810001:Cfap157 UTSW 2 32781432 missense probably damaging 0.96
R0654:Cfap157 UTSW 2 32779942 missense probably damaging 1.00
R0699:Cfap157 UTSW 2 32779010 missense probably damaging 1.00
R1103:Cfap157 UTSW 2 32781398 missense probably damaging 1.00
R1123:Cfap157 UTSW 2 32777923 missense possibly damaging 0.93
R2165:Cfap157 UTSW 2 32778163 splice site probably null
R4304:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4307:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4308:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4439:Cfap157 UTSW 2 32777865 missense probably benign 0.00
R4859:Cfap157 UTSW 2 32777542 missense probably benign 0.00
R4880:Cfap157 UTSW 2 32778249 missense probably damaging 1.00
R4917:Cfap157 UTSW 2 32779953 missense probably benign 0.19
R5808:Cfap157 UTSW 2 32780645 missense probably damaging 1.00
R6052:Cfap157 UTSW 2 32779851 missense probably damaging 1.00
R6405:Cfap157 UTSW 2 32781396 missense probably damaging 1.00
R6502:Cfap157 UTSW 2 32780678 missense probably damaging 1.00
R6959:Cfap157 UTSW 2 32784248 missense probably damaging 1.00
R7123:Cfap157 UTSW 2 32779401 missense probably damaging 0.99
R7469:Cfap157 UTSW 2 32780684 missense probably damaging 1.00
R7527:Cfap157 UTSW 2 32779878 missense possibly damaging 0.86
R7573:Cfap157 UTSW 2 32777508 missense probably benign 0.00
R7697:Cfap157 UTSW 2 32779753 missense probably benign 0.01
R7911:Cfap157 UTSW 2 32778207 missense probably damaging 1.00
R8338:Cfap157 UTSW 2 32778006 missense possibly damaging 0.54
X0020:Cfap157 UTSW 2 32779855 missense probably benign 0.35
Z1177:Cfap157 UTSW 2 32778207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAAAAGGAGTCTGGCCATC -3'
(R):5'- ATGCCTTTGCCTAGAGCCTC -3'

Sequencing Primer
(F):5'- AAGAGGCCCTCTACGATTTG -3'
(R):5'- CCTCAGGGTTTGGACTGTCAGAC -3'
Posted On2018-06-22