Incidental Mutation 'R6647:Vav3'
ID526112
Institutional Source Beutler Lab
Gene Symbol Vav3
Ensembl Gene ENSMUSG00000033721
Gene Namevav 3 oncogene
SynonymsIdd18.1, A530094I06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R6647 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location109340653-109685698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109527416 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 421 (H421L)
Ref Sequence ENSEMBL: ENSMUSP00000036270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046864]
Predicted Effect probably benign
Transcript: ENSMUST00000046864
AA Change: H421L

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000036270
Gene: ENSMUSG00000033721
AA Change: H421L

DomainStartEndE-ValueType
CH 3 115 2.1e-18 SMART
low complexity region 160 175 N/A INTRINSIC
RhoGEF 196 370 5.09e-56 SMART
PH 401 504 1.88e-9 SMART
C1 514 562 2.17e-11 SMART
SH3 595 659 6.4e-6 SMART
SH2 670 752 2.59e-26 SMART
SH3 791 847 8.96e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126179
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. This gene product acts as a GEF preferentially for RhoG, RhoA, and to a lesser extent, RAC1, and it associates maximally with the nucleotide-free states of these GTPases. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in tachycardia, systemic arterial hypertension, cardiovascular remodeling, hyperactivity of sympathetic neurons and thus high catecholamine levels, and increased levels of kidney-related hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,578 N1174Y probably damaging Het
Agl T C 3: 116,750,411 T1416A probably damaging Het
Atp7b A G 8: 22,028,478 S103P probably damaging Het
Ces1h A C 8: 93,352,026 *563G probably null Het
Cfap157 G T 2: 32,779,074 A339E probably benign Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Cyp2b13 A G 7: 26,085,899 H231R possibly damaging Het
Ddx31 A T 2: 28,875,738 T483S probably damaging Het
Defa25 A T 8: 21,085,185 D60V possibly damaging Het
Dnah5 G A 15: 28,403,487 A3453T probably benign Het
Dnah6 A T 6: 73,138,760 F1500I probably damaging Het
Eprs C T 1: 185,414,424 A1217V probably damaging Het
Ermp1 T C 19: 29,626,935 Y481C probably benign Het
Fam159a A G 4: 108,368,027 S113P probably benign Het
Fmn2 T A 1: 174,593,104 N635K unknown Het
Fras1 A G 5: 96,735,202 D2531G probably damaging Het
Frat1 C T 19: 41,830,825 Q220* probably null Het
Gcc2 T A 10: 58,287,281 probably null Het
Gm3285 T C 10: 77,862,613 probably benign Het
Gm9857 T C 3: 108,940,063 probably benign Het
Grin2b C A 6: 135,733,110 W1146L probably damaging Het
Hells T A 19: 38,931,504 L33I probably benign Het
Ift81 T A 5: 122,610,166 R54* probably null Het
Ints12 G A 3: 133,096,878 R41Q possibly damaging Het
Katnal2 C T 18: 76,980,037 E403K probably benign Het
Kcnk1 A G 8: 125,995,460 M1V probably null Het
Kdm5a A G 6: 120,412,461 T950A probably benign Het
Kdr G A 5: 75,952,889 A773V probably damaging Het
Lats1 G C 10: 7,697,507 M118I possibly damaging Het
Mug1 A G 6: 121,840,241 I90V probably benign Het
Nid2 A G 14: 19,802,416 D1064G probably benign Het
Nkx2-4 A T 2: 147,084,267 I225N possibly damaging Het
Nlrp4e A G 7: 23,321,315 D409G probably benign Het
Ogfod2 G C 5: 124,114,803 R292P possibly damaging Het
Olfr1163 A T 2: 88,070,709 F224L probably benign Het
Olfr781 T A 10: 129,333,164 C94* probably null Het
Olfr845 T A 9: 19,338,629 H56Q possibly damaging Het
Olfr935 T C 9: 38,994,914 I174V possibly damaging Het
Oprk1 C T 1: 5,602,284 P215S probably damaging Het
Pcdhb16 A G 18: 37,479,172 K395R possibly damaging Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Pycard T C 7: 127,993,569 T29A probably benign Het
Rap1gap2 G A 11: 74,407,928 A452V probably benign Het
Rasgrf1 C G 9: 90,010,463 T1072S probably benign Het
Rc3h2 G A 2: 37,382,944 R707* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Senp7 T C 16: 56,173,255 I767T probably damaging Het
Setd7 A G 3: 51,542,762 V81A probably benign Het
Shkbp1 A G 7: 27,342,375 S685P probably benign Het
Snrnp200 A G 2: 127,226,452 E904G probably damaging Het
Spata22 T A 11: 73,354,700 probably null Het
Tas2r138 G T 6: 40,612,799 T171K possibly damaging Het
Tor1aip1 T C 1: 156,018,253 D77G possibly damaging Het
Vmn1r43 A G 6: 89,869,859 L215P probably damaging Het
Vmn2r100 T A 17: 19,522,523 S386R probably benign Het
Xpa T A 4: 46,183,089 R233S probably benign Het
Other mutations in Vav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Vav3 APN 3 109528392 splice site probably benign
IGL01488:Vav3 APN 3 109657944 missense probably damaging 0.99
IGL01649:Vav3 APN 3 109562762 missense probably benign
IGL01675:Vav3 APN 3 109664413 missense probably benign 0.16
IGL02189:Vav3 APN 3 109525960 splice site probably benign
IGL03134:Vav3 APN 3 109563094 splice site probably benign
IGL03358:Vav3 APN 3 109647673 missense probably damaging 1.00
PIT4131001:Vav3 UTSW 3 109664435 critical splice donor site probably null
R0511:Vav3 UTSW 3 109664440 splice site probably benign
R0542:Vav3 UTSW 3 109527430 missense probably damaging 1.00
R0630:Vav3 UTSW 3 109424012 missense probably damaging 1.00
R0683:Vav3 UTSW 3 109651813 missense probably benign 0.04
R0833:Vav3 UTSW 3 109647679 missense possibly damaging 0.93
R0836:Vav3 UTSW 3 109647679 missense possibly damaging 0.93
R0940:Vav3 UTSW 3 109562835 missense possibly damaging 0.78
R1561:Vav3 UTSW 3 109494838 critical splice donor site probably null
R1617:Vav3 UTSW 3 109510978 missense probably damaging 1.00
R1760:Vav3 UTSW 3 109341127 missense possibly damaging 0.61
R1834:Vav3 UTSW 3 109506426 missense probably benign 0.06
R1928:Vav3 UTSW 3 109506422 missense possibly damaging 0.94
R2090:Vav3 UTSW 3 109647739 critical splice donor site probably null
R2190:Vav3 UTSW 3 109562814 missense probably damaging 1.00
R2483:Vav3 UTSW 3 109341166 missense probably damaging 1.00
R3124:Vav3 UTSW 3 109628168 critical splice donor site probably null
R3125:Vav3 UTSW 3 109628168 critical splice donor site probably null
R3800:Vav3 UTSW 3 109628039 missense probably benign 0.45
R3919:Vav3 UTSW 3 109527538 missense possibly damaging 0.51
R4693:Vav3 UTSW 3 109563218 splice site probably benign
R4779:Vav3 UTSW 3 109508794 missense possibly damaging 0.88
R5384:Vav3 UTSW 3 109527475 missense possibly damaging 0.92
R5385:Vav3 UTSW 3 109527475 missense possibly damaging 0.92
R5474:Vav3 UTSW 3 109664421 missense probably benign
R5703:Vav3 UTSW 3 109341241 missense probably benign 0.13
R5997:Vav3 UTSW 3 109501461 missense probably damaging 1.00
R6109:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6110:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6120:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6123:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6124:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6186:Vav3 UTSW 3 109516067 missense probably damaging 1.00
R6291:Vav3 UTSW 3 109508854 missense possibly damaging 0.82
R6335:Vav3 UTSW 3 109563196 missense probably benign 0.01
R6849:Vav3 UTSW 3 109521466 missense probably damaging 1.00
R6897:Vav3 UTSW 3 109527494 missense probably damaging 1.00
R7075:Vav3 UTSW 3 109525924 missense possibly damaging 0.47
R7131:Vav3 UTSW 3 109664346 missense probably damaging 1.00
R7328:Vav3 UTSW 3 109503428 missense probably benign 0.10
R7365:Vav3 UTSW 3 109628099 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TTTAAGTTCAAATGAGGGGAGCTGG -3'
(R):5'- GCTCTGCATAAATTACTGTCCATTGC -3'

Sequencing Primer
(F):5'- GAATGGCAGCATCTCTCCTTGAG -3'
(R):5'- ATTGCCACCTCCCCAGTAG -3'
Posted On2018-06-22