Incidental Mutation 'R6647:Ints12'
ID526114
Institutional Source Beutler Lab
Gene Symbol Ints12
Ensembl Gene ENSMUSG00000028016
Gene Nameintegrator complex subunit 12
SynonymsPhf22, 2810027J24Rik, 1110020M19Rik, 4930529N21Rik, A230056J18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6647 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location133091840-133110988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 133096878 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 41 (R41Q)
Ref Sequence ENSEMBL: ENSMUSP00000029650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029650] [ENSMUST00000080583]
PDB Structure
Solution structure of PHD domain in protein NP_082203 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029650
AA Change: R41Q

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029650
Gene: ENSMUSG00000028016
AA Change: R41Q

DomainStartEndE-ValueType
internal_repeat_1 23 67 4.54e-5 PROSPERO
low complexity region 74 82 N/A INTRINSIC
internal_repeat_1 91 139 4.54e-5 PROSPERO
PHD 160 212 4.63e-9 SMART
low complexity region 219 240 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
low complexity region 337 373 N/A INTRINSIC
low complexity region 381 436 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080583
SMART Domains Protein: ENSMUSP00000079421
Gene: ENSMUSG00000028018

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 168 181 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
low complexity region 208 229 N/A INTRINSIC
Pfam:GidB 418 516 1.5e-8 PFAM
Pfam:Methyltransf_32 424 548 1.1e-15 PFAM
Pfam:Methyltransf_31 440 569 2.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160669
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS12 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,578 N1174Y probably damaging Het
Agl T C 3: 116,750,411 T1416A probably damaging Het
Atp7b A G 8: 22,028,478 S103P probably damaging Het
Ces1h A C 8: 93,352,026 *563G probably null Het
Cfap157 G T 2: 32,779,074 A339E probably benign Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Cyp2b13 A G 7: 26,085,899 H231R possibly damaging Het
Ddx31 A T 2: 28,875,738 T483S probably damaging Het
Defa25 A T 8: 21,085,185 D60V possibly damaging Het
Dnah5 G A 15: 28,403,487 A3453T probably benign Het
Dnah6 A T 6: 73,138,760 F1500I probably damaging Het
Eprs C T 1: 185,414,424 A1217V probably damaging Het
Ermp1 T C 19: 29,626,935 Y481C probably benign Het
Fam159a A G 4: 108,368,027 S113P probably benign Het
Fmn2 T A 1: 174,593,104 N635K unknown Het
Fras1 A G 5: 96,735,202 D2531G probably damaging Het
Frat1 C T 19: 41,830,825 Q220* probably null Het
Gcc2 T A 10: 58,287,281 probably null Het
Gm3285 T C 10: 77,862,613 probably benign Het
Gm9857 T C 3: 108,940,063 probably benign Het
Grin2b C A 6: 135,733,110 W1146L probably damaging Het
Hells T A 19: 38,931,504 L33I probably benign Het
Ift81 T A 5: 122,610,166 R54* probably null Het
Katnal2 C T 18: 76,980,037 E403K probably benign Het
Kcnk1 A G 8: 125,995,460 M1V probably null Het
Kdm5a A G 6: 120,412,461 T950A probably benign Het
Kdr G A 5: 75,952,889 A773V probably damaging Het
Lats1 G C 10: 7,697,507 M118I possibly damaging Het
Mug1 A G 6: 121,840,241 I90V probably benign Het
Nid2 A G 14: 19,802,416 D1064G probably benign Het
Nkx2-4 A T 2: 147,084,267 I225N possibly damaging Het
Nlrp4e A G 7: 23,321,315 D409G probably benign Het
Ogfod2 G C 5: 124,114,803 R292P possibly damaging Het
Olfr1163 A T 2: 88,070,709 F224L probably benign Het
Olfr781 T A 10: 129,333,164 C94* probably null Het
Olfr845 T A 9: 19,338,629 H56Q possibly damaging Het
Olfr935 T C 9: 38,994,914 I174V possibly damaging Het
Oprk1 C T 1: 5,602,284 P215S probably damaging Het
Pcdhb16 A G 18: 37,479,172 K395R possibly damaging Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Pycard T C 7: 127,993,569 T29A probably benign Het
Rap1gap2 G A 11: 74,407,928 A452V probably benign Het
Rasgrf1 C G 9: 90,010,463 T1072S probably benign Het
Rc3h2 G A 2: 37,382,944 R707* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Senp7 T C 16: 56,173,255 I767T probably damaging Het
Setd7 A G 3: 51,542,762 V81A probably benign Het
Shkbp1 A G 7: 27,342,375 S685P probably benign Het
Snrnp200 A G 2: 127,226,452 E904G probably damaging Het
Spata22 T A 11: 73,354,700 probably null Het
Tas2r138 G T 6: 40,612,799 T171K possibly damaging Het
Tor1aip1 T C 1: 156,018,253 D77G possibly damaging Het
Vav3 A T 3: 109,527,416 H421L probably benign Het
Vmn1r43 A G 6: 89,869,859 L215P probably damaging Het
Vmn2r100 T A 17: 19,522,523 S386R probably benign Het
Xpa T A 4: 46,183,089 R233S probably benign Het
Other mutations in Ints12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ints12 APN 3 133100809 critical splice donor site probably null
R0243:Ints12 UTSW 3 133109045 missense probably benign 0.37
R0847:Ints12 UTSW 3 133108842 missense possibly damaging 0.72
R2118:Ints12 UTSW 3 133109160 missense probably damaging 0.98
R2323:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R2324:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R2384:Ints12 UTSW 3 133109103 unclassified probably null
R3055:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R3056:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R3919:Ints12 UTSW 3 133100683 missense probably benign
R4431:Ints12 UTSW 3 133102481 missense probably damaging 1.00
R4594:Ints12 UTSW 3 133108868 missense probably benign 0.00
R4598:Ints12 UTSW 3 133098453 missense probably benign
R4599:Ints12 UTSW 3 133098453 missense probably benign
R4702:Ints12 UTSW 3 133096785 missense probably damaging 1.00
R5083:Ints12 UTSW 3 133100777 missense possibly damaging 0.54
R5507:Ints12 UTSW 3 133109160 missense probably damaging 1.00
R5894:Ints12 UTSW 3 133098558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAACATTCATTGTTCCAGAAGGG -3'
(R):5'- TTCTTTGAAGGCATGAGGGAAG -3'

Sequencing Primer
(F):5'- AGGGAGAAGGAAGTCAGATAATTTC -3'
(R):5'- CTTTGAAGGCATGAGGGAAGAGAAC -3'
Posted On2018-06-22