Incidental Mutation 'R6647:Xpa'
ID526115
Institutional Source Beutler Lab
Gene Symbol Xpa
Ensembl Gene ENSMUSG00000028329
Gene Namexeroderma pigmentosum, complementation group A
SynonymsXpac
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6647 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location46155347-46196311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46183089 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 233 (R233S)
Ref Sequence ENSEMBL: ENSMUSP00000121850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030013] [ENSMUST00000058232] [ENSMUST00000132358] [ENSMUST00000142380]
Predicted Effect probably benign
Transcript: ENSMUST00000030013
SMART Domains Protein: ENSMUSP00000030013
Gene: ENSMUSG00000028329

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 99 132 1.5e-20 PFAM
Pfam:XPA_C 133 185 3.7e-28 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058232
SMART Domains Protein: ENSMUSP00000050453
Gene: ENSMUSG00000028329

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 101 132 5.2e-18 PFAM
Pfam:XPA_C 134 185 3e-30 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130051
Predicted Effect probably benign
Transcript: ENSMUST00000132358
SMART Domains Protein: ENSMUSP00000138512
Gene: ENSMUSG00000028329

DomainStartEndE-ValueType
Pfam:XPA_N 1 23 1.1e-13 PFAM
Pfam:XPA_C 24 76 7.9e-29 PFAM
low complexity region 103 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141318
Predicted Effect probably benign
Transcript: ENSMUST00000142380
AA Change: R233S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121850
Gene: ENSMUSG00000028329
AA Change: R233S

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 99 132 1.5e-20 PFAM
Pfam:XPA_C 133 185 3.7e-28 PFAM
low complexity region 212 225 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein involved in DNA excision repair. The encoded protein is part of the NER (nucleotide excision repair) complext which is responsible for repair of UV radiation-induced photoproducts and DNA adducts induced by chemical carcinogens. Mutations in this gene are associated with xeroderma pigmentosum complementation group A. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mutants are highly susceptible to tumors induced by UV (skin and ocular tumors), 7,12-dimethylbenz[a]anthracene (skin tumors), benzo[a]pyrene (pulmonary tumors), 4-nitroquinoline-1-oxide (tongue tumors) and aflatoxin B(1) (liver tumors). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,578 N1174Y probably damaging Het
Agl T C 3: 116,750,411 T1416A probably damaging Het
Atp7b A G 8: 22,028,478 S103P probably damaging Het
Ces1h A C 8: 93,352,026 *563G probably null Het
Cfap157 G T 2: 32,779,074 A339E probably benign Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Cyp2b13 A G 7: 26,085,899 H231R possibly damaging Het
Ddx31 A T 2: 28,875,738 T483S probably damaging Het
Defa25 A T 8: 21,085,185 D60V possibly damaging Het
Dnah5 G A 15: 28,403,487 A3453T probably benign Het
Dnah6 A T 6: 73,138,760 F1500I probably damaging Het
Eprs C T 1: 185,414,424 A1217V probably damaging Het
Ermp1 T C 19: 29,626,935 Y481C probably benign Het
Fam159a A G 4: 108,368,027 S113P probably benign Het
Fmn2 T A 1: 174,593,104 N635K unknown Het
Fras1 A G 5: 96,735,202 D2531G probably damaging Het
Frat1 C T 19: 41,830,825 Q220* probably null Het
Gcc2 T A 10: 58,287,281 probably null Het
Gm3285 T C 10: 77,862,613 probably benign Het
Gm9857 T C 3: 108,940,063 probably benign Het
Grin2b C A 6: 135,733,110 W1146L probably damaging Het
Hells T A 19: 38,931,504 L33I probably benign Het
Ift81 T A 5: 122,610,166 R54* probably null Het
Ints12 G A 3: 133,096,878 R41Q possibly damaging Het
Katnal2 C T 18: 76,980,037 E403K probably benign Het
Kcnk1 A G 8: 125,995,460 M1V probably null Het
Kdm5a A G 6: 120,412,461 T950A probably benign Het
Kdr G A 5: 75,952,889 A773V probably damaging Het
Lats1 G C 10: 7,697,507 M118I possibly damaging Het
Mug1 A G 6: 121,840,241 I90V probably benign Het
Nid2 A G 14: 19,802,416 D1064G probably benign Het
Nkx2-4 A T 2: 147,084,267 I225N possibly damaging Het
Nlrp4e A G 7: 23,321,315 D409G probably benign Het
Ogfod2 G C 5: 124,114,803 R292P possibly damaging Het
Olfr1163 A T 2: 88,070,709 F224L probably benign Het
Olfr781 T A 10: 129,333,164 C94* probably null Het
Olfr845 T A 9: 19,338,629 H56Q possibly damaging Het
Olfr935 T C 9: 38,994,914 I174V possibly damaging Het
Oprk1 C T 1: 5,602,284 P215S probably damaging Het
Pcdhb16 A G 18: 37,479,172 K395R possibly damaging Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Pycard T C 7: 127,993,569 T29A probably benign Het
Rap1gap2 G A 11: 74,407,928 A452V probably benign Het
Rasgrf1 C G 9: 90,010,463 T1072S probably benign Het
Rc3h2 G A 2: 37,382,944 R707* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Senp7 T C 16: 56,173,255 I767T probably damaging Het
Setd7 A G 3: 51,542,762 V81A probably benign Het
Shkbp1 A G 7: 27,342,375 S685P probably benign Het
Snrnp200 A G 2: 127,226,452 E904G probably damaging Het
Spata22 T A 11: 73,354,700 probably null Het
Tas2r138 G T 6: 40,612,799 T171K possibly damaging Het
Tor1aip1 T C 1: 156,018,253 D77G possibly damaging Het
Vav3 A T 3: 109,527,416 H421L probably benign Het
Vmn1r43 A G 6: 89,869,859 L215P probably damaging Het
Vmn2r100 T A 17: 19,522,523 S386R probably benign Het
Other mutations in Xpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Xpa APN 4 46185606 missense probably damaging 1.00
IGL02670:Xpa APN 4 46185682 missense probably benign 0.03
R1863:Xpa UTSW 4 46155730 intron probably benign
R2149:Xpa UTSW 4 46183189 missense probably damaging 0.99
R4534:Xpa UTSW 4 46185624 missense probably benign 0.00
R5308:Xpa UTSW 4 46185659 missense probably benign 0.00
R7157:Xpa UTSW 4 46185612 missense probably damaging 1.00
R7185:Xpa UTSW 4 46183078 missense probably benign
R8191:Xpa UTSW 4 46183225 missense possibly damaging 0.56
R8219:Xpa UTSW 4 46183150 missense probably benign 0.02
Z1177:Xpa UTSW 4 46183036 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GAGTGATGCCTAATCCCACTG -3'
(R):5'- GCTCGACAGTTAGGACTTCC -3'

Sequencing Primer
(F):5'- GATGCCTAATCCCACTGTCCCTAC -3'
(R):5'- TCTGAACCCCAGCTGACTG -3'
Posted On2018-06-22