Incidental Mutation 'R6647:Ift81'
ID526119
Institutional Source Beutler Lab
Gene Symbol Ift81
Ensembl Gene ENSMUSG00000029469
Gene Nameintraflagellar transport 81
SynonymsCDV-1R, Cdv1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6647 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location122550204-122614518 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 122610166 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 54 (R54*)
Ref Sequence ENSEMBL: ENSMUSP00000116467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031426] [ENSMUST00000127220] [ENSMUST00000136024] [ENSMUST00000196452]
Predicted Effect probably null
Transcript: ENSMUST00000031426
AA Change: R54*
SMART Domains Protein: ENSMUSP00000031426
Gene: ENSMUSG00000029469
AA Change: R54*

DomainStartEndE-ValueType
PDB:4LVP|A 5 128 2e-23 PDB
coiled coil region 167 258 N/A INTRINSIC
coiled coil region 308 383 N/A INTRINSIC
coiled coil region 503 591 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127220
AA Change: R54*
SMART Domains Protein: ENSMUSP00000116467
Gene: ENSMUSG00000029469
AA Change: R54*

DomainStartEndE-ValueType
PDB:4LVR|A 1 122 1e-25 PDB
coiled coil region 167 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136024
SMART Domains Protein: ENSMUSP00000118614
Gene: ENSMUSG00000029469

DomainStartEndE-ValueType
PDB:4LVP|A 5 50 4e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144065
Predicted Effect silent
Transcript: ENSMUST00000196452
SMART Domains Protein: ENSMUSP00000143512
Gene: ENSMUSG00000029469

DomainStartEndE-ValueType
PDB:4LVP|A 1 48 4e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196544
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with IFT74, forms a tubulin-binding module of intraflagellar transport complex B. This module is involved in transport of tubulin within the cilium, and the encoded protein is required for ciliogenesis. Mutations in this gene are a cause of short-rib polydactyly syndromes. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,578 N1174Y probably damaging Het
Agl T C 3: 116,750,411 T1416A probably damaging Het
Atp7b A G 8: 22,028,478 S103P probably damaging Het
Ces1h A C 8: 93,352,026 *563G probably null Het
Cfap157 G T 2: 32,779,074 A339E probably benign Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Cyp2b13 A G 7: 26,085,899 H231R possibly damaging Het
Ddx31 A T 2: 28,875,738 T483S probably damaging Het
Defa25 A T 8: 21,085,185 D60V possibly damaging Het
Dnah5 G A 15: 28,403,487 A3453T probably benign Het
Dnah6 A T 6: 73,138,760 F1500I probably damaging Het
Eprs C T 1: 185,414,424 A1217V probably damaging Het
Ermp1 T C 19: 29,626,935 Y481C probably benign Het
Fam159a A G 4: 108,368,027 S113P probably benign Het
Fmn2 T A 1: 174,593,104 N635K unknown Het
Fras1 A G 5: 96,735,202 D2531G probably damaging Het
Frat1 C T 19: 41,830,825 Q220* probably null Het
Gcc2 T A 10: 58,287,281 probably null Het
Gm3285 T C 10: 77,862,613 probably benign Het
Gm9857 T C 3: 108,940,063 probably benign Het
Grin2b C A 6: 135,733,110 W1146L probably damaging Het
Hells T A 19: 38,931,504 L33I probably benign Het
Ints12 G A 3: 133,096,878 R41Q possibly damaging Het
Katnal2 C T 18: 76,980,037 E403K probably benign Het
Kcnk1 A G 8: 125,995,460 M1V probably null Het
Kdm5a A G 6: 120,412,461 T950A probably benign Het
Kdr G A 5: 75,952,889 A773V probably damaging Het
Lats1 G C 10: 7,697,507 M118I possibly damaging Het
Mug1 A G 6: 121,840,241 I90V probably benign Het
Nid2 A G 14: 19,802,416 D1064G probably benign Het
Nkx2-4 A T 2: 147,084,267 I225N possibly damaging Het
Nlrp4e A G 7: 23,321,315 D409G probably benign Het
Ogfod2 G C 5: 124,114,803 R292P possibly damaging Het
Olfr1163 A T 2: 88,070,709 F224L probably benign Het
Olfr781 T A 10: 129,333,164 C94* probably null Het
Olfr845 T A 9: 19,338,629 H56Q possibly damaging Het
Olfr935 T C 9: 38,994,914 I174V possibly damaging Het
Oprk1 C T 1: 5,602,284 P215S probably damaging Het
Pcdhb16 A G 18: 37,479,172 K395R possibly damaging Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Pycard T C 7: 127,993,569 T29A probably benign Het
Rap1gap2 G A 11: 74,407,928 A452V probably benign Het
Rasgrf1 C G 9: 90,010,463 T1072S probably benign Het
Rc3h2 G A 2: 37,382,944 R707* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Senp7 T C 16: 56,173,255 I767T probably damaging Het
Setd7 A G 3: 51,542,762 V81A probably benign Het
Shkbp1 A G 7: 27,342,375 S685P probably benign Het
Snrnp200 A G 2: 127,226,452 E904G probably damaging Het
Spata22 T A 11: 73,354,700 probably null Het
Tas2r138 G T 6: 40,612,799 T171K possibly damaging Het
Tor1aip1 T C 1: 156,018,253 D77G possibly damaging Het
Vav3 A T 3: 109,527,416 H421L probably benign Het
Vmn1r43 A G 6: 89,869,859 L215P probably damaging Het
Vmn2r100 T A 17: 19,522,523 S386R probably benign Het
Xpa T A 4: 46,183,089 R233S probably benign Het
Other mutations in Ift81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Ift81 APN 5 122610968 missense probably damaging 1.00
IGL01867:Ift81 APN 5 122602676 splice site probably benign
IGL01927:Ift81 APN 5 122593129 missense probably benign 0.25
IGL02954:Ift81 APN 5 122610185 splice site probably benign
IGL03003:Ift81 APN 5 122594662 missense probably benign 0.01
R1179:Ift81 UTSW 5 122602710 missense probably benign 0.22
R1394:Ift81 UTSW 5 122568923 missense probably benign 0.00
R1395:Ift81 UTSW 5 122568923 missense probably benign 0.00
R1962:Ift81 UTSW 5 122560709 missense probably benign 0.01
R2084:Ift81 UTSW 5 122567347 missense probably benign 0.00
R4019:Ift81 UTSW 5 122593129 missense probably benign 0.25
R4769:Ift81 UTSW 5 122594593 missense probably benign 0.16
R4849:Ift81 UTSW 5 122591219 missense probably damaging 1.00
R4905:Ift81 UTSW 5 122591079 critical splice donor site probably null
R4924:Ift81 UTSW 5 122594616 missense possibly damaging 0.86
R5110:Ift81 UTSW 5 122551058 missense probably benign 0.02
R5299:Ift81 UTSW 5 122607056 missense probably damaging 0.99
R5387:Ift81 UTSW 5 122555535 missense probably damaging 1.00
R6190:Ift81 UTSW 5 122551100 missense probably benign 0.00
R6241:Ift81 UTSW 5 122602351 missense probably benign 0.38
R6404:Ift81 UTSW 5 122611006 missense probably damaging 1.00
R7155:Ift81 UTSW 5 122568999 missense probably damaging 0.99
R7170:Ift81 UTSW 5 122555533 nonsense probably null
R7699:Ift81 UTSW 5 122594560 missense possibly damaging 0.85
R7700:Ift81 UTSW 5 122594560 missense possibly damaging 0.85
R7709:Ift81 UTSW 5 122609331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAAGGCCATCAGATGAGG -3'
(R):5'- CATTGGAGACTTTAGAAGCTTGAC -3'

Sequencing Primer
(F):5'- GGAGGACCAAGTGTCACCC -3'
(R):5'- AAATGTGACTCTTGATCTGACTTGG -3'
Posted On2018-06-22