Incidental Mutation 'R6647:Tas2r138'
ID526121
Institutional Source Beutler Lab
Gene Symbol Tas2r138
Ensembl Gene ENSMUSG00000058250
Gene Nametaste receptor, type 2, member 138
Synonymsmt2r31, T2R138, Tas2r38
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6647 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location40612315-40613310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 40612799 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 171 (T171K)
Ref Sequence ENSEMBL: ENSMUSP00000075876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076565]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076565
AA Change: T171K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075876
Gene: ENSMUSG00000058250
AA Change: T171K

DomainStartEndE-ValueType
Pfam:TAS2R 11 315 3.8e-64 PFAM
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G protein-coupled receptor that controls the ability to taste glucosinolates, a family of bitter-tasting compounds found in plants of the Brassica sp. Synthetic compounds phenylthiocarbamide (PTC) and 6-n-propylthiouracil (PROP) have been identified as ligands for this receptor and have been used to test the genetic diversity of this gene. Although several allelic forms of this gene have been identified worldwide, there are two predominant common forms (taster and non-taster) found outside of Africa. These alleles differ at three nucleotide positions resulting in amino acid changes in the protein (A49P, A262V, and V296I) with the amino acid combination PAV identifying the taster variant (and AVI identifying the non-taster variant). [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,578 N1174Y probably damaging Het
Agl T C 3: 116,750,411 T1416A probably damaging Het
Atp7b A G 8: 22,028,478 S103P probably damaging Het
Ces1h A C 8: 93,352,026 *563G probably null Het
Cfap157 G T 2: 32,779,074 A339E probably benign Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Cyp2b13 A G 7: 26,085,899 H231R possibly damaging Het
Ddx31 A T 2: 28,875,738 T483S probably damaging Het
Defa25 A T 8: 21,085,185 D60V possibly damaging Het
Dnah5 G A 15: 28,403,487 A3453T probably benign Het
Dnah6 A T 6: 73,138,760 F1500I probably damaging Het
Eprs C T 1: 185,414,424 A1217V probably damaging Het
Ermp1 T C 19: 29,626,935 Y481C probably benign Het
Fam159a A G 4: 108,368,027 S113P probably benign Het
Fmn2 T A 1: 174,593,104 N635K unknown Het
Fras1 A G 5: 96,735,202 D2531G probably damaging Het
Frat1 C T 19: 41,830,825 Q220* probably null Het
Gcc2 T A 10: 58,287,281 probably null Het
Gm3285 T C 10: 77,862,613 probably benign Het
Gm9857 T C 3: 108,940,063 probably benign Het
Grin2b C A 6: 135,733,110 W1146L probably damaging Het
Hells T A 19: 38,931,504 L33I probably benign Het
Ift81 T A 5: 122,610,166 R54* probably null Het
Ints12 G A 3: 133,096,878 R41Q possibly damaging Het
Katnal2 C T 18: 76,980,037 E403K probably benign Het
Kcnk1 A G 8: 125,995,460 M1V probably null Het
Kdm5a A G 6: 120,412,461 T950A probably benign Het
Kdr G A 5: 75,952,889 A773V probably damaging Het
Lats1 G C 10: 7,697,507 M118I possibly damaging Het
Mug1 A G 6: 121,840,241 I90V probably benign Het
Nid2 A G 14: 19,802,416 D1064G probably benign Het
Nkx2-4 A T 2: 147,084,267 I225N possibly damaging Het
Nlrp4e A G 7: 23,321,315 D409G probably benign Het
Ogfod2 G C 5: 124,114,803 R292P possibly damaging Het
Olfr1163 A T 2: 88,070,709 F224L probably benign Het
Olfr781 T A 10: 129,333,164 C94* probably null Het
Olfr845 T A 9: 19,338,629 H56Q possibly damaging Het
Olfr935 T C 9: 38,994,914 I174V possibly damaging Het
Oprk1 C T 1: 5,602,284 P215S probably damaging Het
Pcdhb16 A G 18: 37,479,172 K395R possibly damaging Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Pycard T C 7: 127,993,569 T29A probably benign Het
Rap1gap2 G A 11: 74,407,928 A452V probably benign Het
Rasgrf1 C G 9: 90,010,463 T1072S probably benign Het
Rc3h2 G A 2: 37,382,944 R707* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Senp7 T C 16: 56,173,255 I767T probably damaging Het
Setd7 A G 3: 51,542,762 V81A probably benign Het
Shkbp1 A G 7: 27,342,375 S685P probably benign Het
Snrnp200 A G 2: 127,226,452 E904G probably damaging Het
Spata22 T A 11: 73,354,700 probably null Het
Tor1aip1 T C 1: 156,018,253 D77G possibly damaging Het
Vav3 A T 3: 109,527,416 H421L probably benign Het
Vmn1r43 A G 6: 89,869,859 L215P probably damaging Het
Vmn2r100 T A 17: 19,522,523 S386R probably benign Het
Xpa T A 4: 46,183,089 R233S probably benign Het
Other mutations in Tas2r138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Tas2r138 APN 6 40612586 missense probably benign 0.07
IGL01468:Tas2r138 APN 6 40612476 missense probably benign 0.22
IGL02626:Tas2r138 APN 6 40612715 missense possibly damaging 0.61
IGL03008:Tas2r138 APN 6 40613182 missense probably damaging 1.00
R0595:Tas2r138 UTSW 6 40612865 missense probably damaging 1.00
R2845:Tas2r138 UTSW 6 40612767 missense probably benign 0.09
R2975:Tas2r138 UTSW 6 40613264 missense probably benign 0.00
R4202:Tas2r138 UTSW 6 40612476 missense possibly damaging 0.95
R4923:Tas2r138 UTSW 6 40612886 missense possibly damaging 0.82
R5526:Tas2r138 UTSW 6 40612980 missense probably benign 0.00
R6869:Tas2r138 UTSW 6 40612421 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTCATAGTCCTCATGTGACTC -3'
(R):5'- AAGCCATCCTCACTCTCTGG -3'

Sequencing Primer
(F):5'- ATAGTCCTCATGTGACTCCCCAG -3'
(R):5'- CTCTCTGGATGATTGCAAACCAAGTG -3'
Posted On2018-06-22