Incidental Mutation 'R6647:Cyp2b13'
ID526128
Institutional Source Beutler Lab
Gene Symbol Cyp2b13
Ensembl Gene ENSMUSG00000040583
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 13
Synonymsphenobarbital inducible, type c
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6647 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location26061497-26096197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26085899 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 231 (H231R)
Ref Sequence ENSEMBL: ENSMUSP00000005669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005669
AA Change: H231R

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000005669
Gene: ENSMUSG00000040583
AA Change: H231R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 9.8e-150 PFAM
Meta Mutation Damage Score 0.7635 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,578 N1174Y probably damaging Het
Agl T C 3: 116,750,411 T1416A probably damaging Het
Atp7b A G 8: 22,028,478 S103P probably damaging Het
Ces1h A C 8: 93,352,026 *563G probably null Het
Cfap157 G T 2: 32,779,074 A339E probably benign Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Ddx31 A T 2: 28,875,738 T483S probably damaging Het
Defa25 A T 8: 21,085,185 D60V possibly damaging Het
Dnah5 G A 15: 28,403,487 A3453T probably benign Het
Dnah6 A T 6: 73,138,760 F1500I probably damaging Het
Eprs C T 1: 185,414,424 A1217V probably damaging Het
Ermp1 T C 19: 29,626,935 Y481C probably benign Het
Fam159a A G 4: 108,368,027 S113P probably benign Het
Fmn2 T A 1: 174,593,104 N635K unknown Het
Fras1 A G 5: 96,735,202 D2531G probably damaging Het
Frat1 C T 19: 41,830,825 Q220* probably null Het
Gcc2 T A 10: 58,287,281 probably null Het
Gm3285 T C 10: 77,862,613 probably benign Het
Gm9857 T C 3: 108,940,063 probably benign Het
Grin2b C A 6: 135,733,110 W1146L probably damaging Het
Hells T A 19: 38,931,504 L33I probably benign Het
Ift81 T A 5: 122,610,166 R54* probably null Het
Ints12 G A 3: 133,096,878 R41Q possibly damaging Het
Katnal2 C T 18: 76,980,037 E403K probably benign Het
Kcnk1 A G 8: 125,995,460 M1V probably null Het
Kdm5a A G 6: 120,412,461 T950A probably benign Het
Kdr G A 5: 75,952,889 A773V probably damaging Het
Lats1 G C 10: 7,697,507 M118I possibly damaging Het
Mug1 A G 6: 121,840,241 I90V probably benign Het
Nid2 A G 14: 19,802,416 D1064G probably benign Het
Nkx2-4 A T 2: 147,084,267 I225N possibly damaging Het
Nlrp4e A G 7: 23,321,315 D409G probably benign Het
Ogfod2 G C 5: 124,114,803 R292P possibly damaging Het
Olfr1163 A T 2: 88,070,709 F224L probably benign Het
Olfr781 T A 10: 129,333,164 C94* probably null Het
Olfr845 T A 9: 19,338,629 H56Q possibly damaging Het
Olfr935 T C 9: 38,994,914 I174V possibly damaging Het
Oprk1 C T 1: 5,602,284 P215S probably damaging Het
Pcdhb16 A G 18: 37,479,172 K395R possibly damaging Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Pycard T C 7: 127,993,569 T29A probably benign Het
Rap1gap2 G A 11: 74,407,928 A452V probably benign Het
Rasgrf1 C G 9: 90,010,463 T1072S probably benign Het
Rc3h2 G A 2: 37,382,944 R707* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Senp7 T C 16: 56,173,255 I767T probably damaging Het
Setd7 A G 3: 51,542,762 V81A probably benign Het
Shkbp1 A G 7: 27,342,375 S685P probably benign Het
Snrnp200 A G 2: 127,226,452 E904G probably damaging Het
Spata22 T A 11: 73,354,700 probably null Het
Tas2r138 G T 6: 40,612,799 T171K possibly damaging Het
Tor1aip1 T C 1: 156,018,253 D77G possibly damaging Het
Vav3 A T 3: 109,527,416 H421L probably benign Het
Vmn1r43 A G 6: 89,869,859 L215P probably damaging Het
Vmn2r100 T A 17: 19,522,523 S386R probably benign Het
Xpa T A 4: 46,183,089 R233S probably benign Het
Other mutations in Cyp2b13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Cyp2b13 APN 7 26081727 missense probably benign 0.26
IGL01134:Cyp2b13 APN 7 26081700 missense probably damaging 1.00
IGL02386:Cyp2b13 APN 7 26086013 missense probably damaging 1.00
IGL02531:Cyp2b13 APN 7 26061605 missense possibly damaging 0.55
IGL02960:Cyp2b13 APN 7 26061676 missense probably benign 0.33
R0018:Cyp2b13 UTSW 7 26085950 missense probably benign 0.30
R0018:Cyp2b13 UTSW 7 26085950 missense probably benign 0.30
R0103:Cyp2b13 UTSW 7 26088710 missense probably damaging 1.00
R0121:Cyp2b13 UTSW 7 26086585 missense probably benign
R0392:Cyp2b13 UTSW 7 26085883 missense probably benign 0.01
R0540:Cyp2b13 UTSW 7 26081711 missense probably benign 0.07
R1887:Cyp2b13 UTSW 7 26088650 missense probably damaging 1.00
R2416:Cyp2b13 UTSW 7 26095821 makesense probably null
R2879:Cyp2b13 UTSW 7 26086031 critical splice donor site probably null
R4654:Cyp2b13 UTSW 7 26061647 missense probably damaging 1.00
R4735:Cyp2b13 UTSW 7 26088295 missense probably benign
R4969:Cyp2b13 UTSW 7 26080988 missense probably damaging 0.98
R5174:Cyp2b13 UTSW 7 26088693 missense possibly damaging 0.68
R6243:Cyp2b13 UTSW 7 26061619 missense probably damaging 1.00
R6616:Cyp2b13 UTSW 7 26085881 missense probably benign 0.04
R6766:Cyp2b13 UTSW 7 26081811 critical splice donor site probably null
R6844:Cyp2b13 UTSW 7 26081697 missense probably damaging 1.00
R7431:Cyp2b13 UTSW 7 26061551 missense probably damaging 0.96
R7593:Cyp2b13 UTSW 7 26080991 missense possibly damaging 0.64
R7719:Cyp2b13 UTSW 7 26095670 missense probably damaging 1.00
R7857:Cyp2b13 UTSW 7 26088728 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTGCTTAAGAAATGGGAGTCC -3'
(R):5'- ATGACCACATCCTCATTCTTCAC -3'

Sequencing Primer
(F):5'- CCATGTAAGGCCCAGTGTTC -3'
(R):5'- ATTCTTCACTCTCATCCATCGC -3'
Posted On2018-06-22