Incidental Mutation 'R6647:Olfr845'
ID526136
Institutional Source Beutler Lab
Gene Symbol Olfr845
Ensembl Gene ENSMUSG00000061614
Gene Nameolfactory receptor 845
SynonymsOlfr1522-ps1, MOR150-2, MOR150-1P, GA_x6K02T2PVTD-13076685-13077623, MOR150-1P, MOR150-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6647 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location19336457-19341718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19338629 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 56 (H56Q)
Ref Sequence ENSEMBL: ENSMUSP00000150474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071259] [ENSMUST00000213344] [ENSMUST00000215572]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071259
AA Change: H56Q

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071239
Gene: ENSMUSG00000061614
AA Change: H56Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.1e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213344
AA Change: H56Q

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215572
AA Change: H56Q

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,578 N1174Y probably damaging Het
Agl T C 3: 116,750,411 T1416A probably damaging Het
Atp7b A G 8: 22,028,478 S103P probably damaging Het
Ces1h A C 8: 93,352,026 *563G probably null Het
Cfap157 G T 2: 32,779,074 A339E probably benign Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Cyp2b13 A G 7: 26,085,899 H231R possibly damaging Het
Ddx31 A T 2: 28,875,738 T483S probably damaging Het
Defa25 A T 8: 21,085,185 D60V possibly damaging Het
Dnah5 G A 15: 28,403,487 A3453T probably benign Het
Dnah6 A T 6: 73,138,760 F1500I probably damaging Het
Eprs C T 1: 185,414,424 A1217V probably damaging Het
Ermp1 T C 19: 29,626,935 Y481C probably benign Het
Fam159a A G 4: 108,368,027 S113P probably benign Het
Fmn2 T A 1: 174,593,104 N635K unknown Het
Fras1 A G 5: 96,735,202 D2531G probably damaging Het
Frat1 C T 19: 41,830,825 Q220* probably null Het
Gcc2 T A 10: 58,287,281 probably null Het
Gm3285 T C 10: 77,862,613 probably benign Het
Gm9857 T C 3: 108,940,063 probably benign Het
Grin2b C A 6: 135,733,110 W1146L probably damaging Het
Hells T A 19: 38,931,504 L33I probably benign Het
Ift81 T A 5: 122,610,166 R54* probably null Het
Ints12 G A 3: 133,096,878 R41Q possibly damaging Het
Katnal2 C T 18: 76,980,037 E403K probably benign Het
Kcnk1 A G 8: 125,995,460 M1V probably null Het
Kdm5a A G 6: 120,412,461 T950A probably benign Het
Kdr G A 5: 75,952,889 A773V probably damaging Het
Lats1 G C 10: 7,697,507 M118I possibly damaging Het
Mug1 A G 6: 121,840,241 I90V probably benign Het
Nid2 A G 14: 19,802,416 D1064G probably benign Het
Nkx2-4 A T 2: 147,084,267 I225N possibly damaging Het
Nlrp4e A G 7: 23,321,315 D409G probably benign Het
Ogfod2 G C 5: 124,114,803 R292P possibly damaging Het
Olfr1163 A T 2: 88,070,709 F224L probably benign Het
Olfr781 T A 10: 129,333,164 C94* probably null Het
Olfr935 T C 9: 38,994,914 I174V possibly damaging Het
Oprk1 C T 1: 5,602,284 P215S probably damaging Het
Pcdhb16 A G 18: 37,479,172 K395R possibly damaging Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Pycard T C 7: 127,993,569 T29A probably benign Het
Rap1gap2 G A 11: 74,407,928 A452V probably benign Het
Rasgrf1 C G 9: 90,010,463 T1072S probably benign Het
Rc3h2 G A 2: 37,382,944 R707* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Senp7 T C 16: 56,173,255 I767T probably damaging Het
Setd7 A G 3: 51,542,762 V81A probably benign Het
Shkbp1 A G 7: 27,342,375 S685P probably benign Het
Snrnp200 A G 2: 127,226,452 E904G probably damaging Het
Spata22 T A 11: 73,354,700 probably null Het
Tas2r138 G T 6: 40,612,799 T171K possibly damaging Het
Tor1aip1 T C 1: 156,018,253 D77G possibly damaging Het
Vav3 A T 3: 109,527,416 H421L probably benign Het
Vmn1r43 A G 6: 89,869,859 L215P probably damaging Het
Vmn2r100 T A 17: 19,522,523 S386R probably benign Het
Xpa T A 4: 46,183,089 R233S probably benign Het
Other mutations in Olfr845
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr845 APN 9 19338772 missense possibly damaging 0.56
IGL01637:Olfr845 APN 9 19338964 missense probably damaging 1.00
IGL01767:Olfr845 APN 9 19339302 missense possibly damaging 0.54
IGL01945:Olfr845 APN 9 19339332 missense probably damaging 0.98
IGL02202:Olfr845 APN 9 19339249 missense probably benign 0.06
IGL02877:Olfr845 APN 9 19339201 missense possibly damaging 0.86
R0466:Olfr845 UTSW 9 19339179 missense probably damaging 1.00
R1521:Olfr845 UTSW 9 19338652 missense probably benign 0.35
R1650:Olfr845 UTSW 9 19338647 missense possibly damaging 0.49
R1766:Olfr845 UTSW 9 19338858 missense probably benign 0.06
R2060:Olfr845 UTSW 9 19339056 missense probably benign 0.01
R2082:Olfr845 UTSW 9 19339278 missense probably benign 0.36
R2257:Olfr845 UTSW 9 19338493 missense probably benign 0.01
R2892:Olfr845 UTSW 9 19338738 missense probably benign 0.04
R3156:Olfr845 UTSW 9 19339424 splice site probably null
R3943:Olfr845 UTSW 9 19339075 missense probably benign 0.05
R4116:Olfr845 UTSW 9 19338644 missense probably benign 0.39
R4518:Olfr845 UTSW 9 19339260 missense possibly damaging 0.86
R4814:Olfr845 UTSW 9 19339180 missense probably damaging 1.00
R5339:Olfr845 UTSW 9 19339159 missense possibly damaging 0.78
R7493:Olfr845 UTSW 9 19338813 missense probably damaging 0.98
R7522:Olfr845 UTSW 9 19338998 nonsense probably null
R7584:Olfr845 UTSW 9 19339273 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCACAAGTCTCCTAATTAACATGG -3'
(R):5'- CAAATGGCCACATAGCGGTC -3'

Sequencing Primer
(F):5'- GTCTCCTAATTAACATGGAATCCAC -3'
(R):5'- TCATAGGCCATTGCTGCAAG -3'
Posted On2018-06-22