Mutagenetix > Incidental Mutation

Incidental Mutation 'R6647:Lats1'

526139

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

044768-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R6647 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 7697507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 118 (M118I)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040043
AA Change: M118I

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: M118I

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165952
AA Change: M118I

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: M118I

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217931
AA Change: M118I

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.2945

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	A	1: 26,682,578	N1174Y	probably damaging	Het
Agl	T	C	3: 116,750,411	T1416A	probably damaging	Het
Atp7b	A	G	8: 22,028,478	S103P	probably damaging	Het
Ces1h	A	C	8: 93,352,026	*563G	probably null	Het
Cfap157	G	T	2: 32,779,074	A339E	probably benign	Het
Crebbp	C	T	16: 4,119,806	A698T	possibly damaging	Het
Cyp2b13	A	G	7: 26,085,899	H231R	possibly damaging	Het
Ddx31	A	T	2: 28,875,738	T483S	probably damaging	Het
Defa25	A	T	8: 21,085,185	D60V	possibly damaging	Het
Dnah5	G	A	15: 28,403,487	A3453T	probably benign	Het
Dnah6	A	T	6: 73,138,760	F1500I	probably damaging	Het
Eprs	C	T	1: 185,414,424	A1217V	probably damaging	Het
Ermp1	T	C	19: 29,626,935	Y481C	probably benign	Het
Fam159a	A	G	4: 108,368,027	S113P	probably benign	Het
Fmn2	T	A	1: 174,593,104	N635K	unknown	Het
Fras1	A	G	5: 96,735,202	D2531G	probably damaging	Het
Frat1	C	T	19: 41,830,825	Q220*	probably null	Het
Gcc2	T	A	10: 58,287,281		probably null	Het
Gm3285	T	C	10: 77,862,613		probably benign	Het
Gm9857	T	C	3: 108,940,063		probably benign	Het
Grin2b	C	A	6: 135,733,110	W1146L	probably damaging	Het
Hells	T	A	19: 38,931,504	L33I	probably benign	Het
Ift81	T	A	5: 122,610,166	R54*	probably null	Het
Ints12	G	A	3: 133,096,878	R41Q	possibly damaging	Het
Katnal2	C	T	18: 76,980,037	E403K	probably benign	Het
Kcnk1	A	G	8: 125,995,460	M1V	probably null	Het
Kdm5a	A	G	6: 120,412,461	T950A	probably benign	Het
Kdr	G	A	5: 75,952,889	A773V	probably damaging	Het
Mug1	A	G	6: 121,840,241	I90V	probably benign	Het
Nid2	A	G	14: 19,802,416	D1064G	probably benign	Het
Nkx2-4	A	T	2: 147,084,267	I225N	possibly damaging	Het
Nlrp4e	A	G	7: 23,321,315	D409G	probably benign	Het
Ogfod2	G	C	5: 124,114,803	R292P	possibly damaging	Het
Olfr1163	A	T	2: 88,070,709	F224L	probably benign	Het
Olfr781	T	A	10: 129,333,164	C94*	probably null	Het
Olfr845	T	A	9: 19,338,629	H56Q	possibly damaging	Het
Olfr935	T	C	9: 38,994,914	I174V	possibly damaging	Het
Oprk1	C	T	1: 5,602,284	P215S	probably damaging	Het
Pcdhb16	A	G	18: 37,479,172	K395R	possibly damaging	Het
Ptprg	C	A	14: 11,962,714	P171T	probably damaging	Het
Pycard	T	C	7: 127,993,569	T29A	probably benign	Het
Rap1gap2	G	A	11: 74,407,928	A452V	probably benign	Het
Rasgrf1	C	G	9: 90,010,463	T1072S	probably benign	Het
Rc3h2	G	A	2: 37,382,944	R707*	probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Senp7	T	C	16: 56,173,255	I767T	probably damaging	Het
Setd7	A	G	3: 51,542,762	V81A	probably benign	Het
Shkbp1	A	G	7: 27,342,375	S685P	probably benign	Het
Snrnp200	A	G	2: 127,226,452	E904G	probably damaging	Het
Spata22	T	A	11: 73,354,700		probably null	Het
Tas2r138	G	T	6: 40,612,799	T171K	possibly damaging	Het
Tor1aip1	T	C	1: 156,018,253	D77G	possibly damaging	Het
Vav3	A	T	3: 109,527,416	H421L	probably benign	Het
Vmn1r43	A	G	6: 89,869,859	L215P	probably damaging	Het
Vmn2r100	T	A	17: 19,522,523	S386R	probably benign	Het
Xpa	T	A	4: 46,183,089	R233S	probably benign	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGACACAGCCAGGTCTCAAC -3'
(R):5'- ATTGAACAAATGCTCAGCAGTG -3'

Sequencing Primer
(F):5'- GGTCTCAACCTTGGCATTCATC -3'
(R):5'- CTAGAATCTGACTTTGGGCCAGGAC -3'

Posted On

2018-06-22