Incidental Mutation 'R6568:Slc34a2'
ID 526160
Institutional Source Beutler Lab
Gene Symbol Slc34a2
Ensembl Gene ENSMUSG00000029188
Gene Name solute carrier family 34 (sodium phosphate), member 2
Synonyms D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b
MMRRC Submission
Accession Numbers

Genbank: NM_011402; MGI: 1342284

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6568 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 53038081-53071664 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53069134 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 533 (L533P)
Ref Sequence ENSEMBL: ENSMUSP00000092380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094787]
AlphaFold Q9DBP0
Predicted Effect probably damaging
Transcript: ENSMUST00000094787
AA Change: L533P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: L533P

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 110 252 2.3e-26 PFAM
Pfam:Na_Pi_cotrans 374 551 2.6e-17 PFAM
low complexity region 553 570 N/A INTRINSIC
low complexity region 616 645 N/A INTRINSIC
low complexity region 649 655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147243
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T C 1: 138,852,134 K127E possibly damaging Het
Ash1l G A 3: 89,052,037 M2240I probably benign Het
Ccr5 G A 9: 124,125,199 A280T probably damaging Het
Ceacam5 C T 7: 17,745,491 L178F probably damaging Het
Col2a1 T C 15: 97,977,276 N1259S unknown Het
Doc2b A C 11: 75,776,994 probably null Het
Fryl T C 5: 73,059,516 N2144D probably damaging Het
Gm10093 A G 17: 78,492,588 Y336C probably damaging Het
Gm5096 A T 18: 87,757,442 Y363F probably benign Het
Ighv1-34 A T 12: 114,851,611 W5R probably benign Het
Kdr A G 5: 75,961,774 V497A probably benign Het
Miip T A 4: 147,865,915 M75L probably benign Het
Mplkip T C 13: 17,695,677 S65P probably damaging Het
Ms4a13 A G 19: 11,191,559 L34P probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nek1 T C 8: 61,106,821 S896P probably benign Het
Olfr199 A T 16: 59,216,278 C112S probably benign Het
Polr3b T A 10: 84,634,903 M136K probably damaging Het
Rgsl1 A C 1: 153,821,546 W508G possibly damaging Het
Ros1 A T 10: 52,162,812 M354K probably damaging Het
Taf2 G A 15: 55,064,630 L126F probably damaging Het
Tlr12 T C 4: 128,617,992 D155G probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Zfp942 T G 17: 21,929,062 K195N probably benign Het
Other mutations in Slc34a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Slc34a2 APN 5 53065608 missense probably benign 0.06
IGL00845:Slc34a2 APN 5 53058354 splice site probably benign
IGL01024:Slc34a2 APN 5 53067630 missense possibly damaging 0.61
IGL01300:Slc34a2 APN 5 53068127 critical splice acceptor site probably null
IGL01680:Slc34a2 APN 5 53060876 missense probably damaging 1.00
IGL02226:Slc34a2 APN 5 53067731 missense probably benign 0.12
IGL02682:Slc34a2 APN 5 53059238 missense possibly damaging 0.64
IGL03294:Slc34a2 APN 5 53063998 missense probably benign 0.00
tucumcari UTSW 5 53064009 missense possibly damaging 0.68
D4216:Slc34a2 UTSW 5 53065497 missense probably benign 0.01
R0094:Slc34a2 UTSW 5 53063968 missense probably benign 0.28
R0227:Slc34a2 UTSW 5 53069626 missense possibly damaging 0.51
R0524:Slc34a2 UTSW 5 53064873 nonsense probably null
R0836:Slc34a2 UTSW 5 53067707 missense probably benign
R1525:Slc34a2 UTSW 5 53069506 missense probably benign 0.00
R1655:Slc34a2 UTSW 5 53069419 missense probably benign 0.00
R1753:Slc34a2 UTSW 5 53061391 missense probably benign 0.37
R1838:Slc34a2 UTSW 5 53058436 missense probably benign
R2361:Slc34a2 UTSW 5 53068145 missense probably benign 0.10
R2405:Slc34a2 UTSW 5 53058181 missense probably benign 0.04
R3688:Slc34a2 UTSW 5 53064832 missense probably benign 0.06
R4108:Slc34a2 UTSW 5 53064009 missense possibly damaging 0.68
R4176:Slc34a2 UTSW 5 53067568 missense probably damaging 1.00
R4380:Slc34a2 UTSW 5 53069286 missense probably damaging 1.00
R4464:Slc34a2 UTSW 5 53069182 missense probably damaging 0.99
R4780:Slc34a2 UTSW 5 53069451 missense probably damaging 1.00
R4816:Slc34a2 UTSW 5 53069020 missense probably damaging 1.00
R4934:Slc34a2 UTSW 5 53067600 missense probably damaging 1.00
R5265:Slc34a2 UTSW 5 53061434 missense probably damaging 0.96
R5309:Slc34a2 UTSW 5 53069488 missense probably damaging 0.96
R5313:Slc34a2 UTSW 5 53069339 missense probably damaging 0.96
R5884:Slc34a2 UTSW 5 53069380 missense possibly damaging 0.46
R6084:Slc34a2 UTSW 5 53067647 missense possibly damaging 0.91
R6310:Slc34a2 UTSW 5 53064797 critical splice acceptor site probably null
R6817:Slc34a2 UTSW 5 53064028 missense probably damaging 0.98
R6845:Slc34a2 UTSW 5 53069169 missense probably damaging 0.96
R6944:Slc34a2 UTSW 5 53064883 missense probably benign
R7873:Slc34a2 UTSW 5 53058372 missense probably benign 0.02
R8114:Slc34a2 UTSW 5 53068359 missense probably benign 0.00
R8158:Slc34a2 UTSW 5 53060840 missense probably damaging 1.00
R8364:Slc34a2 UTSW 5 53068374 missense possibly damaging 0.75
R9158:Slc34a2 UTSW 5 53063875 missense possibly damaging 0.95
R9235:Slc34a2 UTSW 5 53069325 missense probably benign 0.00
R9314:Slc34a2 UTSW 5 53060801 missense possibly damaging 0.61
Z1176:Slc34a2 UTSW 5 53060817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAGACCTGGAGTGACTCTTAC -3'
(R):5'- TTGTCCCAGGGTTTCAGAGAG -3'

Sequencing Primer
(F):5'- AGACCTGGAGTGACTCTTACTTCTTC -3'
(R):5'- GGTTTCAGAGAGTGCATCCAC -3'
Posted On 2018-06-22